ID: 1138769504

View in Genome Browser
Species Human (GRCh38)
Location 16:59647353-59647375
Sequence GCAGCTAATACGTGGCATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138769499_1138769504 18 Left 1138769499 16:59647312-59647334 CCAAGGGCAGCTCTGAAGTACAG No data
Right 1138769504 16:59647353-59647375 GCAGCTAATACGTGGCATTCAGG No data
1138769498_1138769504 26 Left 1138769498 16:59647304-59647326 CCATTTATCCAAGGGCAGCTCTG No data
Right 1138769504 16:59647353-59647375 GCAGCTAATACGTGGCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138769504 Original CRISPR GCAGCTAATACGTGGCATTC AGG Intergenic
No off target data available for this crispr