ID: 1138769529

View in Genome Browser
Species Human (GRCh38)
Location 16:59647593-59647615
Sequence CCTACCACATAGGATTTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138769524_1138769529 -3 Left 1138769524 16:59647573-59647595 CCAGACATGCCGGTTTCAACCCT No data
Right 1138769529 16:59647593-59647615 CCTACCACATAGGATTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138769529 Original CRISPR CCTACCACATAGGATTTTGT AGG Intergenic
No off target data available for this crispr