ID: 1138777162

View in Genome Browser
Species Human (GRCh38)
Location 16:59736957-59736979
Sequence TGAGATCTAAAAACAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 447}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138777162 Original CRISPR TGAGATCTAAAAACAGAAGA TGG (reversed) Intronic
900987183 1:6080073-6080095 TGAAATATAAAAACAGAAAACGG + Intronic
902421048 1:16280390-16280412 TGGGATCTTAGAACAGAAAAAGG + Intronic
902934168 1:19752538-19752560 AGTGATTTAAAAACAGAAGGTGG - Intronic
906560470 1:46753036-46753058 TGAGAGTAGAAAACAGAAGAGGG - Intergenic
908635197 1:66155893-66155915 TCAGAAATAAAAACAGAAGCAGG - Intronic
909161322 1:72153713-72153735 TCAGACCTAAAAACAGAACCTGG + Intronic
909351702 1:74660982-74661004 TGAGAAAGAAAAAAAGAAGAAGG + Intronic
910847548 1:91617927-91617949 TGAGATTTGAAATCAGAACAGGG + Intergenic
911138092 1:94464574-94464596 TGTTATCTAAAAACTGAATAAGG - Intronic
911152546 1:94609262-94609284 TGAGAGCAGAAAACAGAAGGTGG + Intergenic
911520857 1:98928302-98928324 TTATATCTAAATACAGAATAAGG + Intronic
911987250 1:104642922-104642944 TTAGATTTAAAAAGTGAAGAAGG + Intergenic
912127981 1:106564065-106564087 TGAGATTTAAAGTAAGAAGAGGG + Intergenic
912253677 1:108037307-108037329 TGACATCTAAACAGAGAACAAGG - Intergenic
912340883 1:108913876-108913898 TGAGATCTTAAAATAGAAAGGGG + Intronic
912953722 1:114137917-114137939 TGAGCTCTACAAGCAGAAGTCGG - Exonic
913043402 1:115052237-115052259 TGTGCTCTAAATACAGAAAAGGG + Intronic
913129009 1:115821169-115821191 AGAGATATAAAATCAAAAGAAGG + Intergenic
915659789 1:157393375-157393397 TTAAATCTAAAAACATAAAATGG - Intergenic
915777978 1:158512137-158512159 TGAGATTCAAAAACAGCAGAAGG - Intergenic
916268277 1:162914340-162914362 TGAAAACTAAAAACAGGAGAGGG - Intergenic
917577845 1:176343004-176343026 TGAGATCAAAAACAAGAAGAGGG - Intergenic
917878543 1:179309823-179309845 TGATATATAAAAACAAAACATGG - Intronic
918094526 1:181323823-181323845 TGAGATCCAACAAAAAAAGAAGG - Intergenic
918811764 1:189131709-189131731 AGAAGTCTAAAAACAGAAGAAGG - Intergenic
919135408 1:193501506-193501528 GGAAATCTACAAGCAGAAGAAGG - Intergenic
919212256 1:194502596-194502618 CCAGATCTACAAATAGAAGATGG + Intergenic
919336712 1:196244815-196244837 AGAGCTCTACAAACAGAAGGTGG - Intronic
919578837 1:199345736-199345758 TGAAATGTTAAAAAAGAAGATGG - Intergenic
921247887 1:213264849-213264871 TGAGATCTAAGAACAAAGCAAGG - Intronic
921276951 1:213530210-213530232 GGAGATGGAAAAACAGGAGATGG - Intergenic
921337123 1:214099414-214099436 TAAGGTCTATAAACAGAGGAAGG - Intergenic
921639276 1:217532816-217532838 TGAGGTCAGAGAACAGAAGAGGG + Intronic
922195745 1:223359116-223359138 AGAGACCTAGAAACAGAAAAAGG + Intronic
922463470 1:225830153-225830175 AGAGATTTAAAAGCAGAAGCTGG + Intronic
922626516 1:227051021-227051043 TTATAACTAAAAACACAAGAGGG + Intronic
923035442 1:230281836-230281858 TGAGTTTTAAAAACAGGAGTGGG - Exonic
923150035 1:231224653-231224675 TGAGAACTGAACAAAGAAGAGGG - Intronic
923320278 1:232825345-232825367 TCAGATGTATAAACAGAAAATGG + Intergenic
923785880 1:237068811-237068833 GGAGATCTAAAAACAGTAAAGGG - Intronic
924410668 1:243801878-243801900 TTATATCCAAAAACTGAAGAAGG + Intronic
1063287183 10:4703089-4703111 TGAAATCCATTAACAGAAGATGG - Intergenic
1063640874 10:7829377-7829399 TGGGATCCAGAAACAGAAAAAGG - Intronic
1063650484 10:7931657-7931679 TGAGATTTGAAAACATAACATGG - Intronic
1064968761 10:21041581-21041603 TGAGATTTAAAATCACTAGAAGG + Intronic
1065508484 10:26454138-26454160 TGGGATCTAAAAATAGAAACAGG + Intronic
1065659480 10:27990886-27990908 TGAGATTTAAAAATAAAATATGG + Intronic
1068009237 10:51427194-51427216 AGAGATACAAAAAGAGAAGAAGG + Intronic
1068664496 10:59658698-59658720 AGGGATGCAAAAACAGAAGATGG - Intronic
1069199488 10:65594860-65594882 TGGGATCTTAGAACAGAAAACGG + Intergenic
1069580332 10:69561580-69561602 TGAGATGCAAGAGCAGAAGAAGG + Intergenic
1070027236 10:72643438-72643460 ACAGATATAAAAACAGAAAATGG + Intergenic
1070613464 10:77950473-77950495 TGAGCTATAAAAATTGAAGATGG - Intergenic
1071404064 10:85311654-85311676 TGAGAAGTAAAAACTCAAGAAGG - Intergenic
1071864015 10:89705331-89705353 TCAGCACTAAAAACATAAGATGG - Exonic
1071879672 10:89882814-89882836 TCAAATCTAAAAACAGACAATGG - Intergenic
1071967181 10:90863692-90863714 AGAGATCAAAAGACAGAACATGG + Intergenic
1072992084 10:100206116-100206138 TGAGATCTTAGAACAGAAAAAGG + Intronic
1073827435 10:107340677-107340699 TGATGTCCAAAAGCAGAAGATGG + Intergenic
1075620107 10:123920842-123920864 TGAGAGAGAAAAAGAGAAGAGGG - Intronic
1076244398 10:128934741-128934763 TGGGATCTCAAAACAGAAAATGG - Intergenic
1077628682 11:3796472-3796494 TGAGAACTAAACTTAGAAGATGG - Intronic
1078082601 11:8215143-8215165 TGACTTGTCAAAACAGAAGAAGG - Intergenic
1078161924 11:8847959-8847981 TGCTATCTAAAAACAACAGAAGG + Intronic
1078418540 11:11187008-11187030 TGAGATCAAGAAATAGAACATGG - Intergenic
1079732404 11:23951356-23951378 AGAGATATAAATACAGAAAATGG - Intergenic
1080056969 11:27916620-27916642 TGAGAGCCAAAACCACAAGAAGG + Intergenic
1080242608 11:30143914-30143936 TGAGCTCTAAAACCAGCTGAGGG - Intergenic
1080305667 11:30832121-30832143 CTAGATCTAAAAAGAGAAAATGG + Intronic
1081199942 11:40203631-40203653 TGAATTCTACAAACAGAAAAGGG + Intronic
1083365333 11:62138696-62138718 TCAGAACTGAAAACAGAAGAGGG - Exonic
1083581064 11:63825911-63825933 TGAAAGGCAAAAACAGAAGATGG - Intronic
1083982380 11:66183449-66183471 TGAGTTCTTTAATCAGAAGATGG - Intronic
1085757811 11:79216133-79216155 TGAGATGGGAGAACAGAAGAAGG - Intronic
1087186269 11:95200450-95200472 AAAGATCTAAAAGCAGAAAATGG + Intronic
1087801909 11:102513627-102513649 TGGGACCTAAAAAAAAAAGATGG - Intergenic
1088712614 11:112522107-112522129 TGACATTTAAAAAAAGGAGAAGG + Intergenic
1089062246 11:115634884-115634906 TGAGAATTAAAAAAAAAAGAAGG + Intergenic
1089371838 11:117966165-117966187 TGAAACCTAAAAAAAGTAGAAGG + Intergenic
1090452058 11:126815327-126815349 TGAGAGCTAAGAACAGAATCAGG - Intronic
1090525345 11:127528593-127528615 TGAGATCCAAAGGCAGAACAAGG - Intergenic
1090641362 11:128731686-128731708 TGAAATCTTAAAATAGGAGACGG - Intronic
1090875537 11:130785643-130785665 GGAGTGCTAAAAACAGAAGCAGG - Intergenic
1091384385 12:83566-83588 TGTGTTCAAAGAACAGAAGAAGG + Intronic
1093354022 12:18140868-18140890 TGAGATCTGAGAAGAAAAGACGG + Intronic
1093705593 12:22271791-22271813 AGAGATCTAAGAACAGTGGAGGG - Intronic
1093756798 12:22861930-22861952 TGGAATGGAAAAACAGAAGAAGG - Intergenic
1094290839 12:28847888-28847910 TGAGTTCTAAAGACATAAAATGG + Intergenic
1095172876 12:39056044-39056066 TGAGATCACACAACAGATGAGGG + Intergenic
1096608562 12:52785836-52785858 TGAAATCTAAAAACACAACTTGG + Intergenic
1096815095 12:54196893-54196915 TGAGACCCAAAATCAGGAGAAGG + Intergenic
1096986702 12:55764220-55764242 TGAGATGTAATAAAAGAATAAGG + Intronic
1098776448 12:74626043-74626065 TAATTTCTAAACACAGAAGAAGG - Intergenic
1099417563 12:82410779-82410801 TGAGATCTAAAAACTAATAATGG + Intronic
1099709414 12:86202823-86202845 TGAAATCTATAAAAAGAAAATGG - Intronic
1099799147 12:87435237-87435259 TGAGGTATACAAACAGCAGATGG - Intergenic
1099992496 12:89739295-89739317 TGAAATCTAAAAACATACAATGG + Intergenic
1100023354 12:90098102-90098124 GGAAAACAAAAAACAGAAGAAGG - Intergenic
1101007034 12:100411067-100411089 TGGGTTCTAAACACAGAATATGG + Intronic
1101641966 12:106592643-106592665 TGATGCCTAAAAACATAAGAGGG - Intronic
1101873231 12:108582332-108582354 TGAGATTTAAACACTGAGGAAGG + Intergenic
1102708770 12:114906770-114906792 TGAGATCCTAGAACAGAAAAAGG - Intergenic
1103377328 12:120467770-120467792 TGCATTCGAAAAACAGAAGAGGG + Intronic
1104124782 12:125835945-125835967 TGAGATCCCAGAACAGAAAAAGG - Intergenic
1104364619 12:128165786-128165808 TGATATTTAAAAAAAAAAGACGG + Intergenic
1106750805 13:32765053-32765075 TAAGATTTAAAAACTGAACAAGG - Intronic
1107288919 13:38829644-38829666 TGAAATCTAAAAAAAAAAAAAGG - Intronic
1108128102 13:47267009-47267031 TGAGACCTAATTACATAAGAAGG + Intergenic
1108846921 13:54689775-54689797 TAAGATCAAAAATCACAAGAAGG - Intergenic
1108897872 13:55357615-55357637 TGAGTTATAACAACAGAAAAAGG + Intergenic
1109305616 13:60637656-60637678 TGAGGTATAGAAACAGCAGATGG - Intergenic
1109557636 13:64001038-64001060 AGAAATCTAAACACAGAATAAGG - Intergenic
1109765934 13:66897385-66897407 TGTGAGCAAAAAACAGAGGAAGG + Intronic
1109878303 13:68434777-68434799 GGAAATCTAAAAACAAAAAAAGG + Intergenic
1110483391 13:76010229-76010251 TGAATTCTAAAAATAGAAAAAGG + Intergenic
1110749806 13:79099817-79099839 TGACATCTGAAAACATATGAAGG + Intergenic
1112114556 13:96338012-96338034 TCACATCTAAAAATAGAAAAAGG - Intronic
1112665228 13:101563258-101563280 TTAAATCCAAAAACAGGAGAAGG + Intronic
1114740316 14:25090104-25090126 TGAGCTATAAAGACAGTAGAGGG + Intergenic
1115470036 14:33759064-33759086 GGAGATCTAAACTCAGAAGTGGG - Intronic
1116860366 14:49990643-49990665 TCAGATCTGAACACAGAAGCTGG + Intronic
1117725790 14:58672349-58672371 GGAGATTTAAAAAAAGAAGCCGG - Intergenic
1117884729 14:60348559-60348581 GGTGGTCTAAAAACAGGAGAGGG + Intergenic
1118550942 14:66949484-66949506 TGATCTCTAAAAAGAGAAGTTGG + Intronic
1118562780 14:67104869-67104891 CCAGATCCAAAATCAGAAGAAGG - Intronic
1118872570 14:69755403-69755425 TGACATAAAAAAACAGAGGAGGG + Intronic
1118882157 14:69838494-69838516 TGAGATCTTACAACAGAAAAAGG - Intergenic
1118882596 14:69842075-69842097 TGAAATCAGAAAACAGAAAATGG + Intergenic
1119972293 14:78984793-78984815 TAGGAACTAAAAACAGGAGAGGG + Intronic
1120103465 14:80469716-80469738 TATGCTCAAAAAACAGAAGAGGG + Intergenic
1121189411 14:92012283-92012305 ATAGATCTATAAAAAGAAGAGGG + Intronic
1121218545 14:92267179-92267201 TGAGATCCTAGAACAGAACAAGG - Intergenic
1122457795 14:101868057-101868079 TCAGCTATAAAAATAGAAGAAGG - Intronic
1202900982 14_GL000194v1_random:38594-38616 TGAAATCTACAACCATAAGAAGG + Intergenic
1123787648 15:23688795-23688817 AGATATCTATAAATAGAAGAAGG - Intergenic
1125588033 15:40835654-40835676 TGAGTTTTAAAAACAGTAAAGGG - Intergenic
1125854374 15:42934943-42934965 TGAGATCCCAGAACAGAAAAAGG - Intergenic
1127029881 15:54850426-54850448 TGAGATAAAAAAAAAGGAGACGG + Intergenic
1127206669 15:56727609-56727631 TGAAAACTAGAAACAGATGAAGG - Intronic
1130049686 15:80473485-80473507 AGAGAATTAAAAACGGAAGAGGG - Intronic
1131286000 15:91058016-91058038 TCAAAAGTAAAAACAGAAGAAGG - Intergenic
1131329003 15:91478661-91478683 TGACATCTAAGCACAGAAGTTGG + Intergenic
1132222879 15:100118047-100118069 AGAGATGTAACAGCAGAAGAGGG + Intronic
1133464279 16:6015162-6015184 TAAGATCTAAAAATCTAAGAAGG - Intergenic
1133594548 16:7279009-7279031 TAAAATCTAAAAACTGATGACGG + Intronic
1135536255 16:23296703-23296725 TGAGATCGAAGATCAGAGGACGG + Intronic
1135536412 16:23297808-23297830 TAAGATCAAAATACAGATGAGGG + Intronic
1135835164 16:25818860-25818882 TGATATCTGAAGACAGAGGATGG + Intronic
1136032431 16:27513540-27513562 TTAGATCTGAAGACAGAGGAAGG + Intronic
1138745801 16:59362292-59362314 GCAGTTCTAAAAACAGAAAATGG - Intergenic
1138777162 16:59736957-59736979 TGAGATCTAAAAACAGAAGATGG - Intronic
1138893381 16:61173018-61173040 TGAGAGCTAAAAAAAAAAAAAGG + Intergenic
1140127589 16:72131151-72131173 TGAGATGTAGAAAAAGAAGTGGG + Intronic
1140667157 16:77238269-77238291 TGAGATATTAACACATAAGAAGG + Intergenic
1140964962 16:79956939-79956961 TGAGAGATGCAAACAGAAGATGG - Intergenic
1141072864 16:80973839-80973861 TAAGACCTAAAAACAGTAGGTGG + Exonic
1141648771 16:85381451-85381473 GGAGATCTATACCCAGAAGAAGG - Intergenic
1141821095 16:86446472-86446494 TGAGTTGTTAAAAGAGAAGAGGG - Intergenic
1143371293 17:6441725-6441747 TCAGATATAACAACAGAAAACGG - Intergenic
1144490848 17:15707462-15707484 TGACTTCTAATAACTGAAGAAGG + Intronic
1144701187 17:17341705-17341727 TAAGAGGTAAAAATAGAAGAGGG - Intronic
1146505983 17:33405836-33405858 TAAGAGCCAGAAACAGAAGATGG - Intronic
1147177148 17:38663137-38663159 AGAGATCCAAAAAAAGATGATGG + Intergenic
1147967564 17:44201055-44201077 TGAAAACTAAAAACCAAAGATGG - Intergenic
1149619300 17:58030374-58030396 TGGGATCTTGGAACAGAAGAAGG + Intergenic
1149925540 17:60698546-60698568 TGAAATCTAAAATAAGAAAAAGG + Intronic
1150899838 17:69260613-69260635 TGAGACCTAAAAAGGGAAGCAGG + Intronic
1151028488 17:70706912-70706934 CGGGATCTAAAAACCGAATAGGG + Intergenic
1151276755 17:73040441-73040463 TGGTATCTGAGAACAGAAGAAGG + Intronic
1153534937 18:6091397-6091419 TGAGATGTAAAAGCAAAAGTAGG + Intronic
1154094207 18:11395470-11395492 GGAGATCTGAAAAAGGAAGAAGG - Intergenic
1155558944 18:27053835-27053857 TGAGCTCTAAAAGCTGAATAGGG - Intronic
1155823114 18:30403263-30403285 TGAAATATAAAAACAAATGATGG - Intergenic
1156024136 18:32631952-32631974 TGACATCTGAGGACAGAAGATGG + Intergenic
1156161191 18:34360153-34360175 TGACATATATAATCAGAAGATGG - Intergenic
1156700721 18:39821123-39821145 TGAGAGAGAAAAACAGAAGAAGG + Intergenic
1157831466 18:50860451-50860473 TGATATCCAAGAGCAGAAGATGG + Intergenic
1158433577 18:57416081-57416103 TGAATTCTAAACACAGAATATGG + Intergenic
1159904385 18:74076926-74076948 TGAGATGGACAAAGAGAAGATGG - Intronic
1162045395 19:7996504-7996526 TAAGCTCTCAAAACAGAAGCAGG + Intronic
1163099573 19:15086362-15086384 AGAGAAGGAAAAACAGAAGATGG + Intergenic
1164767980 19:30786364-30786386 CGAGTTTTTAAAACAGAAGAGGG - Intergenic
1164814841 19:31189152-31189174 TGTTAATTAAAAACAGAAGAGGG - Intergenic
1166818184 19:45559730-45559752 TGAGATCTAAAAGAAGAATTGGG - Intronic
1167870502 19:52365544-52365566 TGAGAGCTGAAAACACAAGGGGG - Intronic
1167876069 19:52413698-52413720 TGAAAACAAAAAACAGGAGAGGG - Intronic
1168528081 19:57104555-57104577 AAAGATCTAAAAACCGAAAAAGG - Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927618814 2:24629550-24629572 TGAGATTTAAAAACAAAAAAAGG + Intronic
928018430 2:27681054-27681076 GGAGATGAAAAAGCAGAAGATGG - Intronic
928462416 2:31486623-31486645 TGAGATATGAAAGAAGAAGATGG - Intergenic
929735918 2:44549096-44549118 TAAGATTTGAAAACAGAAAAAGG - Intronic
930198528 2:48531023-48531045 TAATATCTAAAGACAGAAGAAGG + Intronic
930930043 2:56870585-56870607 TGAAATTTAATAACAAAAGAGGG + Intergenic
930967502 2:57348079-57348101 TTAAATCTAATAACAGAAAAAGG + Intergenic
931123757 2:59250650-59250672 TGAGATCTTGAAACAAAACAAGG + Intergenic
931533705 2:63247862-63247884 TCACAACTAAAAACAAAAGAAGG - Intronic
931978695 2:67670913-67670935 TGAGACCTAAATGCAGATGAGGG + Intergenic
932072220 2:68632265-68632287 GCAGATCTAAAATCAGAAAAGGG + Intergenic
932453407 2:71830752-71830774 TGAGATCTCACATCAGAAGCTGG - Intergenic
932491526 2:72126038-72126060 TGGGATCTCAAAACAGGAAATGG - Intergenic
933092228 2:78135713-78135735 TGAGTTCTAAAAAGAGGAGCTGG - Intergenic
933360234 2:81272406-81272428 TGAAATCTCCAAACAAAAGATGG + Intergenic
934077906 2:88443433-88443455 TGAGATTTTAAAACAAAAAAAGG - Intergenic
934505807 2:94892507-94892529 TGAAATCTACAACCATAAGAAGG - Intergenic
935985990 2:108673815-108673837 GAAGATCTAAAAACAAAAAAAGG + Intronic
936138431 2:109917434-109917456 GAAGATCTAAAAACAAAAAAAGG + Intergenic
936206265 2:110454051-110454073 GAAGATCTAAAAACAAAAAAAGG - Intronic
936279911 2:111129592-111129614 TGAAATCTCAATACAGTAGATGG - Intronic
936371565 2:111906164-111906186 TGAGATCTAAATCCGGAGGATGG - Intronic
936677998 2:114738064-114738086 GGAGAGATAAAAAGAGAAGAGGG + Intronic
936772513 2:115931670-115931692 TGAGAGTTAAAAACTGCAGAAGG - Intergenic
936850320 2:116888884-116888906 TGAAATCTAAAAACAGAAGTAGG - Intergenic
937048272 2:118864638-118864660 TGAGACCTAAAAGGAGCAGATGG + Intergenic
938372938 2:130784843-130784865 TAAGATCTTGAAACAGAAAAGGG + Intergenic
938762375 2:134437401-134437423 TGACATCTACAAACAGCTGAGGG - Intronic
939236070 2:139495195-139495217 TGAGATTCTAAAACTGAAGAAGG + Intergenic
939436776 2:142187035-142187057 TGAAATCTTAAAAAAAAAGAGGG - Intergenic
939681288 2:145136996-145137018 TGAGATCTTGAAACAGGAAAAGG + Intergenic
939951908 2:148485430-148485452 TAAAATCTAAAAATAGATGAAGG + Intronic
940654444 2:156471061-156471083 TAAGATCTAGAAAGAGAAGCAGG - Intronic
941504488 2:166324898-166324920 TGAGATCTTGAAAGAGAAAAAGG + Intronic
942187729 2:173440252-173440274 TGAGATCCCAGAACAGAAAAGGG - Intergenic
942986177 2:182145037-182145059 TGAGGTCTAAAAACAACAGGAGG - Intronic
943430182 2:187790003-187790025 TGAGATCTAAAAAATGAAATCGG + Intergenic
944197480 2:197069890-197069912 AGAGATCTAAAAAAAAAAAAAGG - Intronic
944585765 2:201172065-201172087 TGAGATATAAAATGAAAAGAAGG - Exonic
944610330 2:201397974-201397996 TGGGATCTAAGAACAGTGGAAGG + Intronic
944929281 2:204500197-204500219 TGAAATTTAAAAAATGAAGAGGG + Intergenic
945416650 2:209581536-209581558 TGAAATCTAAAAAGAGAGAATGG - Intronic
945540541 2:211081060-211081082 TGATAGGTAAAAACACAAGATGG + Intergenic
945613298 2:212033294-212033316 TGGGATCTCAAAAGAGAAGCTGG + Intronic
947134026 2:226958898-226958920 AGAGATCTCAAAAGAGCAGAAGG - Intronic
947576216 2:231276877-231276899 AGAAAACTAAAAACAGAAAAAGG + Intronic
947945677 2:234100088-234100110 TGAGACTTTGAAACAGAAGATGG - Intergenic
1170015464 20:11776340-11776362 TGGGATCTTGAAACAGAAAAAGG + Intergenic
1171017442 20:21554647-21554669 TTACATCTAAAAGCAGAAAATGG + Intergenic
1171893396 20:30737986-30738008 TGAAATCTACAACCATAAGAAGG - Intergenic
1172212629 20:33211716-33211738 TGGGATCCAAAAGCAGAAAATGG + Intergenic
1174377780 20:50137947-50137969 TGGGATCCAGGAACAGAAGAAGG + Intronic
1174856423 20:54049765-54049787 GGAGCTCTAAAAACAGCAGCTGG - Intronic
1175846552 20:62062674-62062696 ACTGATCTTAAAACAGAAGATGG + Intronic
1176620356 21:9053372-9053394 TGAAATCTACAACCATAAGAAGG + Intergenic
1177094727 21:16818698-16818720 TTGGAACTAACAACAGAAGATGG - Intergenic
1177295237 21:19165216-19165238 TGAGCTAGAAAAATAGAAGAGGG - Intergenic
1178174337 21:30078844-30078866 AGAGAAGTAAAAACAGAAAAAGG - Intergenic
1178560919 21:33639033-33639055 TGAGATCTAAAGATAGATAAAGG + Intronic
1178988184 21:37326741-37326763 GGAGACCTAAAAAGAGAGGAAGG - Intergenic
1179271786 21:39857141-39857163 TCAGATCTAAAAATAGAGCAAGG + Intergenic
1179936278 21:44606510-44606532 TTAGATATAAAACCAGAAGTGGG - Intronic
1180756807 22:18168081-18168103 TGAGTTATAACAACAGAAAATGG - Intronic
1181074960 22:20369362-20369384 TGAGTTATAACAACAGAAAATGG + Intronic
1181476969 22:23174520-23174542 CGAGATTTAAAAACATAATATGG + Intergenic
1182437729 22:30341369-30341391 TGAGAGCTCAAAACAGAACAGGG + Intronic
949697876 3:6720290-6720312 TGAGATCCTAGAACAGAAAAAGG + Intergenic
950315804 3:12001251-12001273 TGCAATCTAAAAAGAGAAGCTGG + Intergenic
952045136 3:29309914-29309936 TGAGATTTAAAATTAGAAAAGGG + Intronic
952751388 3:36827649-36827671 TGATCACAAAAAACAGAAGAAGG + Exonic
954056725 3:48032188-48032210 TGAGATCCTAGAACAGAAAAAGG + Intronic
954132040 3:48565829-48565851 AGAGATGGAAAAAGAGAAGAAGG + Intronic
956072205 3:65465658-65465680 TGAAAACTAAAACCAGAAAAAGG - Intronic
957396681 3:79648277-79648299 CACGATCTAATAACAGAAGATGG - Intronic
957656744 3:83088509-83088531 TGAGAACTAAAACAAGAAGGCGG + Intergenic
959530245 3:107428166-107428188 TGGGCTCTAAAATCAGAAAATGG + Intergenic
959583868 3:108007937-108007959 TGTGATCTAGAGACAGAACAAGG - Intergenic
959635221 3:108559269-108559291 AGAACACTAAAAACAGAAGAGGG + Intronic
960214772 3:115018448-115018470 GGAGATCAAAGAACAAAAGATGG - Intronic
962668087 3:137676246-137676268 TGAAATCTAAAAACATACAATGG + Intergenic
962769222 3:138596648-138596670 TGATATCAAAGAAGAGAAGAGGG + Intergenic
963505621 3:146181180-146181202 TGAACTCTAAAAACAGAAATGGG + Intergenic
963963669 3:151340309-151340331 TGAGATTTAAATACAGATAAAGG - Intronic
964283444 3:155092018-155092040 TGATGTCTAAGAACAGGAGAAGG + Intronic
965261533 3:166491652-166491674 TGAGACTTAAAAACATAAGAGGG - Intergenic
965269121 3:166589871-166589893 TGAGATCTTAGGACAGAAAAGGG + Intergenic
967390510 3:188949614-188949636 TGACATCTAAATAGAGGAGATGG - Intronic
967443451 3:189536665-189536687 TCATATTTAAAAACAGAAAAGGG - Intergenic
969150964 4:5168031-5168053 GGAGATGCAAACACAGAAGATGG - Intronic
971523479 4:27585603-27585625 AGAGAGATACAAACAGAAGAAGG + Intergenic
971685600 4:29762474-29762496 TGATTTCTAAAAAAAAAAGAGGG - Intergenic
972758426 4:42076335-42076357 TGAGATATAGAAAGAGAAAATGG - Intronic
975095517 4:70452416-70452438 TGAAATCTAAAAACATATAATGG - Intronic
975416756 4:74113478-74113500 AGAGATCAAAAGAGAGAAGAGGG - Intergenic
976457314 4:85263261-85263283 TGAGACCTAGAGACAGAAAAAGG - Intergenic
976480750 4:85541770-85541792 TGCCATAAAAAAACAGAAGAAGG + Intronic
976681178 4:87757858-87757880 TGAGATATTAAAACAGATGCTGG - Intergenic
977331106 4:95638620-95638642 TGAGAACACAATACAGAAGAGGG + Intergenic
977636651 4:99305867-99305889 TGAGATCCAGAAAAAGAAAATGG - Exonic
978746561 4:112201479-112201501 TGAAATGTATAAAAAGAAGAGGG - Intergenic
978862743 4:113470306-113470328 TGAGATCTGATAAAAGAAGTAGG - Intronic
978952187 4:114574208-114574230 TGGGATCCAAGAACAGAAAAAGG - Intergenic
979425811 4:120564328-120564350 TGAGAAGTGAAAAAAGAAGAGGG + Intergenic
979708273 4:123747355-123747377 TGAGATCTAGACGCAGAAGGAGG + Intergenic
979899997 4:126203581-126203603 TGAGATCTAAAACAAGAAGGTGG - Intergenic
980060881 4:128128066-128128088 TGATATCTACAAACAAAAGAAGG + Intronic
980795472 4:137676812-137676834 TGAGATCTTGAAACAGAAACAGG + Intergenic
981022478 4:140043190-140043212 TGAGAAATAAAGAGAGAAGAGGG - Intronic
981045574 4:140261995-140262017 TGAGGTCTAATAAGAAAAGATGG - Intronic
981274292 4:142879898-142879920 TGAGATCTAAAAACTCCAGGGGG + Intergenic
981642495 4:146960957-146960979 TGATTGCTAAAAACAGCAGAAGG + Intergenic
982599422 4:157427551-157427573 TGAGATCCTGAAACAGAAAAAGG - Intergenic
983140035 4:164138693-164138715 TGAGGGCTAAGAACTGAAGAGGG + Intronic
983167915 4:164499490-164499512 TGAGATATAAAAAATGAAAAGGG - Intergenic
983700267 4:170583615-170583637 TGTGATCTAAGAAAAGGAGAAGG + Intergenic
984027050 4:174555480-174555502 TGGGATCTTGGAACAGAAGAAGG - Intergenic
984154024 4:176172180-176172202 TAAGATCTAAAAACAGTAAGAGG - Intronic
984936123 4:184890666-184890688 TGGGATATAAAAACAACAGATGG + Intergenic
985527961 5:416626-416648 TGGGATCTGAGCACAGAAGATGG - Intronic
986345651 5:6833040-6833062 TCAGCTGTAATAACAGAAGAGGG - Intergenic
986355951 5:6926467-6926489 TGAGAGTTAAAAAAAGCAGAGGG - Intergenic
986559764 5:9048796-9048818 AGTGATCTAAAAACATTAGAGGG + Intronic
987314284 5:16709835-16709857 TGAGATATAAACACAAAACAGGG - Intronic
987427333 5:17788224-17788246 AGAGATGAAAAAAGAGAAGACGG - Intergenic
987652218 5:20757231-20757253 TAGGATCTCAAAACAGAAAAGGG - Intergenic
987955152 5:24729347-24729369 TCAGATCTAAAAAAAAAAAAAGG + Intergenic
987965026 5:24861469-24861491 TGACACCTAACAACTGAAGAAGG + Intergenic
988275245 5:29073175-29073197 TGAGATACAAAATCAGAAGAGGG + Intergenic
988691872 5:33580586-33580608 TAATATTTTAAAACAGAAGATGG + Intronic
988743347 5:34104249-34104271 TAGGATCTCAAAACAGAAAAGGG + Intronic
989454005 5:41621187-41621209 TGAGCTGGAATAACAGAAGAAGG - Intergenic
990596753 5:57319825-57319847 TCAGCTCCAAAAGCAGAAGAAGG - Intergenic
990766939 5:59194595-59194617 TGGGAAATAAAAGCAGAAGAAGG + Intronic
991131230 5:63124314-63124336 TAAAATGTAAAAACATAAGAGGG + Intergenic
991211591 5:64111196-64111218 GTAGATCTAAAAACATAAGTAGG - Intergenic
991699046 5:69300068-69300090 TGATATCAAACAGCAGAAGATGG - Exonic
992030513 5:72716770-72716792 TGAGAGGTAAAAACAGATTATGG - Intergenic
993345824 5:86780890-86780912 TTGGATCTAAAATCAGAAGTAGG - Intergenic
994982604 5:106895246-106895268 AAAGCTCTAGAAACAGAAGAGGG + Intergenic
995050355 5:107696481-107696503 TGAGATCTGGAGAGAGAAGAGGG + Intergenic
995955983 5:117776822-117776844 TGAGATTTGACAACAAAAGAAGG - Intergenic
996613008 5:125406432-125406454 ACAGGTCTAAAAGCAGAAGAAGG + Intergenic
998578830 5:143348517-143348539 TGAGAGCTAAAACAAGAAGGTGG - Intronic
998756529 5:145386983-145387005 TGATCTTTAGAAACAGAAGAGGG - Intergenic
998875826 5:146598116-146598138 TGAGTTCAAGAAACTGAAGATGG - Intronic
999363282 5:151004176-151004198 TAAAATTTAAAAAAAGAAGAAGG + Intergenic
999551627 5:152693912-152693934 TGAGAGCTGAAAACCAAAGAAGG + Intergenic
999637991 5:153642292-153642314 TGAGGTCTAGAAACAGCACAAGG - Intronic
1000118449 5:158175018-158175040 TGAGACTTAAAAAGAGAAGCTGG + Intergenic
1000180119 5:158801004-158801026 TGAGATTTAAAACCAGAAATTGG - Intronic
1000639195 5:163681188-163681210 TGATATTTAAAAAGAAAAGAAGG - Intergenic
1001490683 5:172152741-172152763 TGACATCTAAACACAGATCAAGG + Intronic
1001728873 5:173932859-173932881 AGAGATCTAAAACCAGAAAAAGG + Intronic
1001804231 5:174569792-174569814 CCAGATGGAAAAACAGAAGAAGG + Intergenic
1003847699 6:10190377-10190399 TGACAACTACAAACAGGAGATGG + Intronic
1005872683 6:29986807-29986829 TGATTTCTAATATCAGAAGAGGG + Intergenic
1006776950 6:36601135-36601157 GGAGATCTAAAAGCAGAAACAGG - Exonic
1008180246 6:48319349-48319371 TGAGATAGAAAATCAGGAGAGGG + Intergenic
1008237812 6:49071257-49071279 GGAGATCCAAAAACAGTAGTTGG - Intergenic
1008396256 6:51011135-51011157 TGAGATCTCAGAACAGAAAAAGG - Intergenic
1009271748 6:61623104-61623126 TTACATTTACAAACAGAAGAAGG + Intergenic
1009280944 6:61750636-61750658 AGAGACCTAGAATCAGAAGACGG - Intronic
1009524408 6:64725823-64725845 TAGGATGTAAAAACAGAAGAAGG - Intronic
1009828535 6:68898967-68898989 TGAGATATTAGAACAGAAAAAGG + Intronic
1009848617 6:69166178-69166200 TGCAATCTCAATACAGAAGAGGG + Intronic
1010329817 6:74609957-74609979 TAAGATCTGAAATCAGAAAAGGG - Intergenic
1010469458 6:76209354-76209376 TGGGATTTAGGAACAGAAGAAGG - Intergenic
1011137996 6:84120137-84120159 TGATGTCCAAAATCAGAAGAAGG + Intergenic
1012036373 6:94146218-94146240 TGAGACCTAAAAAGAGCAAATGG + Intergenic
1012111772 6:95244143-95244165 TGATTTCCAAAAGCAGAAGATGG - Intergenic
1012246439 6:96931264-96931286 TGATATTTCAACACAGAAGAAGG - Intronic
1012558890 6:100553674-100553696 TGCAATCTAAAAACAGTAGCAGG - Intronic
1013235346 6:108193752-108193774 TGAGATTTTAGAACAGAAGGAGG - Intergenic
1014151551 6:118062288-118062310 TGAGATCTAAAAAGATTAAATGG + Intronic
1015021845 6:128486317-128486339 TGGGATTTCAAAGCAGAAGAGGG - Intronic
1015193662 6:130501249-130501271 TGAGAGAGAAAAAGAGAAGATGG + Intergenic
1015923749 6:138290117-138290139 TGAGACGTGAAAAGAGAAGAGGG + Intronic
1016338939 6:143040070-143040092 TAAAATATAAAAACATAAGAGGG - Intergenic
1017416413 6:154225920-154225942 GGAGGACTAAAAACAGTAGATGG - Intronic
1018219195 6:161561689-161561711 AGAGATCCAAGAACTGAAGAAGG - Intronic
1018524689 6:164695944-164695966 TGAAAAATAAAAACAGAAAATGG + Intergenic
1018989847 6:168665824-168665846 TGAAATAATAAAACAGAAGAAGG + Intronic
1020429849 7:8107662-8107684 TTAGATCCCAAAACAGAAAAAGG - Intergenic
1020909512 7:14111070-14111092 TGTGAATTAAAAACAAAAGACGG - Intergenic
1021019578 7:15579839-15579861 TGAAAAATAACAACAGAAGAAGG - Intergenic
1021724519 7:23536203-23536225 TGACATCTAAAAAGCAAAGATGG - Intergenic
1022962140 7:35437643-35437665 TGAGAGCCACAAACTGAAGATGG - Intergenic
1023525721 7:41100738-41100760 TGAAATCTAAATATAGAAAATGG - Intergenic
1023646119 7:42317984-42318006 TAAAAACTAAAAACAGAAAATGG + Intergenic
1023708713 7:42969203-42969225 TTAGATCTTGAAACAGAAAAAGG - Intergenic
1024402300 7:48939053-48939075 TGGTATCTAAAAACAGATGAAGG - Intergenic
1026303674 7:69121549-69121571 TAAGTTGTAAAAACAGAAGAAGG + Intergenic
1026385654 7:69845175-69845197 TGGCATCTAAAACAAGAAGATGG + Intronic
1026670717 7:72388409-72388431 TGAGATCCAAGCACAGAAAAAGG + Intronic
1027449254 7:78311194-78311216 AGAGAAAGAAAAACAGAAGATGG + Intronic
1027984256 7:85265963-85265985 TGAGAACTAAAAAAAATAGATGG - Intergenic
1028306742 7:89275200-89275222 TGAGAAAGAAAAAGAGAAGATGG - Intronic
1028419660 7:90618660-90618682 TGTGCTCTAATAGCAGAAGACGG - Intronic
1028656854 7:93218538-93218560 AGAGATCAAAAATCAGAAGTTGG + Intronic
1029067730 7:97868907-97868929 TGAAATCTACAACCATAAGAAGG - Exonic
1029264444 7:99327107-99327129 AGGTATCTAAAAACAGAGGAGGG + Intronic
1029816535 7:103102263-103102285 CTAGATTTAAAAACAGAAAATGG + Exonic
1029847347 7:103426296-103426318 TTAGATCTCAAAACATAAGATGG + Intronic
1030019089 7:105254989-105255011 TAAGATCTATAAAAAGCAGATGG - Intronic
1030150291 7:106397784-106397806 TGTGATCTAGAGAGAGAAGAGGG + Intergenic
1030667349 7:112294026-112294048 AGAGATGTTAGAACAGAAGATGG - Intronic
1030912479 7:115268517-115268539 TTATATTTAAAAACAGATGAAGG + Intergenic
1030994444 7:116341342-116341364 TCAGAACTAAAAACAGAAACTGG - Intronic
1031220579 7:118959525-118959547 TAAGATAAAAAAACACAAGAAGG - Intergenic
1031580007 7:123461711-123461733 TGAGATTTAAAAAAAAAAGTTGG + Intronic
1032757001 7:134900615-134900637 TGGGATCTAAATACAGATGTGGG - Intronic
1032903555 7:136338292-136338314 TGTGATTTAGAAACAGGAGAGGG - Intergenic
1033572354 7:142643235-142643257 TGGGATGTAAAAACAAAAGAGGG + Intergenic
1033934776 7:146570517-146570539 TGACATCTAAAAATTGAAGCAGG + Intronic
1035132229 7:156666166-156666188 TGAGATCCTAAAACATATGAGGG - Intronic
1035854607 8:2961223-2961245 TGTGATTTAAAAAGAAAAGAGGG + Intronic
1037058489 8:14476287-14476309 AGAGAACAAAAAGCAGAAGATGG + Intronic
1037267215 8:17076871-17076893 TCAGATCTGAAAATAGAAGTGGG + Intronic
1037865099 8:22437127-22437149 TGAGATCTAAATACAGTAGTCGG - Intergenic
1040355521 8:46614276-46614298 TGAAATCTACAACCATAAGAAGG - Intergenic
1040958002 8:52999713-52999735 AGAGATCACAAATCAGAAGAGGG + Intergenic
1041644136 8:60234342-60234364 TGAGATCCCAGAACAGAAGAAGG + Intronic
1041681049 8:60591874-60591896 AGAGAAGTAAAAAAAGAAGAAGG + Exonic
1041773612 8:61499438-61499460 TGAGATCTAACAAGAGGGGAGGG - Exonic
1042763964 8:72300579-72300601 TGACAAATATAAACAGAAGAGGG + Intergenic
1043623947 8:82231193-82231215 CTATATCTAAAAAAAGAAGAAGG + Intergenic
1044343629 8:91076789-91076811 TAATATCTTAAAACACAAGATGG - Intronic
1044687236 8:94838541-94838563 TGAGATGTACTATCAGAAGAAGG - Exonic
1045453584 8:102353564-102353586 TGGGATCTTAGAACAGAAAAAGG + Intronic
1045478361 8:102572687-102572709 TGGGATCTTGAAACAGAAAAGGG + Intergenic
1045760982 8:105607371-105607393 AGAGATCTGAGAAAAGAAGAAGG + Intronic
1045823000 8:106363604-106363626 TGTTCACTAAAAACAGAAGATGG - Intronic
1046102611 8:109631983-109632005 AGAGAACTAAAAAGACAAGAAGG + Intronic
1048146991 8:131854777-131854799 TGAAATTTAAAAAAAGAAGGAGG - Intergenic
1049334856 8:142078582-142078604 TTAGATTTAAAAACACAAAACGG - Intergenic
1050030363 9:1379438-1379460 TGACATCTAAAAATTCAAGATGG + Intergenic
1050400388 9:5247603-5247625 TGAGATGTGAGGACAGAAGATGG + Intergenic
1050810107 9:9734384-9734406 TGAGATTCAAACTCAGAAGATGG + Intronic
1051012957 9:12440862-12440884 TGAATTATAAAAACATAAGATGG - Intergenic
1051136518 9:13928267-13928289 TAAGTTTTAAAAACAGAACACGG + Intergenic
1051240959 9:15055178-15055200 TGAGTTCCAAAAAAAGAAAATGG - Intergenic
1051730094 9:20132151-20132173 GGAGATCTAAAGACAGGAGTAGG - Intergenic
1052212413 9:25921557-25921579 AGAGTTCCAAAAAAAGAAGAAGG + Intergenic
1052443697 9:28531959-28531981 TGATATCTAAAAGCATAAAATGG + Intronic
1052527245 9:29633922-29633944 TGAATTATCAAAACAGAAGAAGG + Intergenic
1052884872 9:33635288-33635310 TGGGATGTAAAAACAAAAGAGGG + Intergenic
1054355242 9:64054730-64054752 TGAAATCTACAACCATAAGAAGG + Intergenic
1054782318 9:69176393-69176415 TGAGATCTAAAGATACAAGTAGG + Intronic
1055046072 9:71925484-71925506 TGATACCAAAAAACTGAAGAAGG + Intronic
1055786420 9:79873910-79873932 TCTGAACTAAAGACAGAAGAGGG + Intergenic
1055838270 9:80471665-80471687 TGACACCTAATAACAGAAGGAGG + Intergenic
1056437911 9:86590816-86590838 TCAGACCTAGAAACAGAAGGTGG - Intergenic
1057142764 9:92737575-92737597 TGAGATCCAGAAACAGAAGCTGG + Intronic
1057749832 9:97783208-97783230 TGACATCTTAGAACAGAATAGGG + Intergenic
1058227050 9:102377954-102377976 TGAGATGTGAAGATAGAAGATGG - Intergenic
1058900474 9:109438231-109438253 TGAGCTATCAAGACAGAAGAAGG + Exonic
1059510218 9:114838259-114838281 TGAGATCTTGGAACAGAAAAAGG - Intergenic
1059799341 9:117734246-117734268 TTAGACCTAGAAACAGAACATGG - Intergenic
1062312332 9:135945569-135945591 TTAGATCTGAACACAGAAGCAGG + Intronic
1203482883 Un_GL000224v1:23080-23102 TAAGATCAAAACACAGACGAAGG - Intergenic
1203566542 Un_KI270744v1:95688-95710 TGAAATCTACAACCATAAGAAGG - Intergenic
1186583264 X:10843968-10843990 TGAGATCTTGGAACAGAAAAAGG + Intergenic
1187552979 X:20324477-20324499 TGGGATCCAGAAACAGAAAAAGG - Intergenic
1187647568 X:21365177-21365199 TGAAATTTAAAAAAAGAAGATGG - Intergenic
1187709996 X:22043695-22043717 TTAAATCTAAAAACAGAGGCTGG + Intronic
1187897128 X:23992550-23992572 GGAGATCAAAAAACAAAGGAAGG + Intronic
1188979882 X:36717424-36717446 TGAGATATATTAACAGATGAGGG + Intergenic
1189101866 X:38198916-38198938 TCAGATCAAGAAACAGAACATGG + Intronic
1189153565 X:38731764-38731786 TGTGATCTAAAAACAAAAGTTGG + Intergenic
1189745235 X:44162059-44162081 TGAGATCTTAGAACAGTAGTTGG + Intronic
1189905157 X:45751409-45751431 TGATAAGTAAAAACAAAAGAAGG + Intergenic
1190642433 X:52493777-52493799 TGAGATCTAAATACAGCCCATGG + Intergenic
1190645240 X:52519090-52519112 TGAGATCTAAATACAGCCCATGG - Intronic
1190737583 X:53266092-53266114 TGACATCTATAAAAAGGAGAAGG - Intronic
1191658078 X:63621245-63621267 TGGGATCCTAAAACAGAAAAAGG - Intergenic
1191841599 X:65517175-65517197 TGAGATCACAAGACAGAATAAGG - Intronic
1192145011 X:68676194-68676216 GCAGACTTAAAAACAGAAGAGGG - Intronic
1193642769 X:84032202-84032224 TGAGATCTAACATAACAAGAAGG + Intergenic
1194237751 X:91405714-91405736 TGAGATCTAAATCAAGAACACGG + Intergenic
1194737829 X:97535111-97535133 TGAGATCCCGAAACAGAAAAAGG + Intronic
1195699248 X:107690064-107690086 GGAGCACTAAAAACAGAACAGGG + Intergenic
1196416894 X:115480613-115480635 AGAGATGTAAACACAGTAGATGG + Intergenic
1196921080 X:120585789-120585811 TGAGATCCTAGAACAGAAAAAGG - Intergenic
1197759337 X:130016498-130016520 TGAGATCGGAAAGCGGAAGAAGG + Intronic
1198137858 X:133772052-133772074 TGAAAACTAAATACAGGAGAAGG - Intronic
1198580770 X:138061951-138061973 TGAGATTGAAAAACACAGGATGG + Intergenic
1199074345 X:143511992-143512014 AGAGATCGAAGAACAGAAAAAGG - Intronic
1199093348 X:143715259-143715281 AGAGATCGAAGAACAGAAAAAGG - Intronic
1199535023 X:148892943-148892965 AGAGCTCTAGAAACAGCAGATGG + Intronic
1199938354 X:152599845-152599867 TAAGATTTGAAAACAGAAAAAGG + Intergenic
1200413689 Y:2886649-2886671 TGAAAATTAAAAACAGAACAGGG - Intronic
1202578686 Y:26355566-26355588 TGAGATCTAAAAAAACCAAAAGG + Intergenic