ID: 1138777434

View in Genome Browser
Species Human (GRCh38)
Location 16:59740914-59740936
Sequence GGGAAGGTTAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 9, 2: 18, 3: 44, 4: 224}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138777430_1138777434 3 Left 1138777430 16:59740888-59740910 CCACTTTCAATTTTATGCAAATT 0: 1
1: 7
2: 106
3: 327
4: 1755
Right 1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG 0: 1
1: 9
2: 18
3: 44
4: 224
1138777429_1138777434 4 Left 1138777429 16:59740887-59740909 CCCACTTTCAATTTTATGCAAAT 0: 1
1: 9
2: 106
3: 308
4: 1063
Right 1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG 0: 1
1: 9
2: 18
3: 44
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138777434 Original CRISPR GGGAAGGTTAATGCAAATTG AGG Intronic