ID: 1138777434

View in Genome Browser
Species Human (GRCh38)
Location 16:59740914-59740936
Sequence GGGAAGGTTAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 9, 2: 18, 3: 44, 4: 224}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138777430_1138777434 3 Left 1138777430 16:59740888-59740910 CCACTTTCAATTTTATGCAAATT 0: 1
1: 7
2: 106
3: 327
4: 1755
Right 1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG 0: 1
1: 9
2: 18
3: 44
4: 224
1138777429_1138777434 4 Left 1138777429 16:59740887-59740909 CCCACTTTCAATTTTATGCAAAT 0: 1
1: 9
2: 106
3: 308
4: 1063
Right 1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG 0: 1
1: 9
2: 18
3: 44
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138777434 Original CRISPR GGGAAGGTTAATGCAAATTG AGG Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
906244440 1:44263113-44263135 GGGAAGGTTAATGGAACTTCTGG - Intronic
906499874 1:46333820-46333842 AAGCAGGCTAATGCAAATTGAGG - Intergenic
906785769 1:48614613-48614635 TGCAAGGGTAATGCAAACTGGGG - Intronic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
910023839 1:82624938-82624960 CTGAAGGTTTAAGCAAATTGTGG + Intergenic
910922841 1:92368024-92368046 GGAAAGGATAATTCAGATTGTGG + Intronic
911941273 1:104051072-104051094 GTGAATGTTTAAGCAAATTGTGG + Intergenic
913681285 1:121188289-121188311 GTGAAGGGTAAAGCAAAATGTGG + Intronic
913703937 1:121399265-121399287 GGAAAGTGTAATGCAAAATGTGG + Intergenic
913980288 1:143500973-143500995 GGAAAGTGTAATGCAAAATGTGG + Intergenic
914033116 1:143975929-143975951 GTGAAGGGTAAAGCAAAATGTGG + Intergenic
914074636 1:144326459-144326481 GGAAAGTGTAATGCAAAATGTGG + Intergenic
914104540 1:144639987-144640009 GGAAAGTGTAATGCAAAATGTGG - Intergenic
914156329 1:145092037-145092059 GTGAAGGGTAAAGCAAAGTGTGG - Intronic
914254386 1:145949496-145949518 GGGAAGTGTAATGCAAGATGAGG + Intronic
915812011 1:158923131-158923153 GGGTAGGTGACTGCAAAGTGAGG + Intergenic
916429502 1:164713472-164713494 AGGAAGGTTTATGCAGAATGTGG - Intronic
916701765 1:167303112-167303134 GGGGAGGTTAATGTCAAATGTGG + Intronic
917401792 1:174657835-174657857 GAGAAGGTAGATACAAATTGGGG - Intronic
918088998 1:181271557-181271579 GGAATGGTTACTTCAAATTGAGG + Intergenic
920468601 1:206206814-206206836 GTGAAGGGTAAAGCAAAATGTGG + Intronic
920636741 1:207711584-207711606 GGGCACATCAATGCAAATTGAGG - Intronic
920941535 1:210487923-210487945 GGGATGGTGAAGGCAAATTATGG - Intronic
922968607 1:229715315-229715337 GGACAGGTTAATGCAAATTGAGG - Intergenic
923995896 1:239494090-239494112 AGGCAGGTTAATTCAAATTGAGG + Intronic
1063925783 10:10975946-10975968 GGGTGGGTCAATGGAAATTGAGG + Intergenic
1063966825 10:11352513-11352535 GGCCAGGTTAATGCAAACTGAGG + Intergenic
1064710903 10:18123421-18123443 GAGTGGGTTAATGCAAATGGAGG - Intergenic
1064800469 10:19064954-19064976 GAGCAGATTAATGCAAATTGAGG + Intronic
1065228869 10:23576185-23576207 GGGAATGCTAATGAAAATTTTGG - Intergenic
1065827616 10:29586210-29586232 AGGCTGGTTAATGCAATTTGAGG + Intronic
1065950257 10:30645079-30645101 AGGCTGGTTAATGCAATTTGAGG - Intergenic
1066781049 10:38944772-38944794 GGAAAGTGTAATGCAAAATGTGG + Intergenic
1066953836 10:42147353-42147375 GGAAAGTGTAATGCAAAATGTGG - Intergenic
1068257491 10:54532325-54532347 GGGAAGGAGAAGGCATATTGTGG - Intronic
1070383771 10:75905198-75905220 GGGAAGTTTAATGCATTTTCTGG - Intronic
1070423202 10:76258605-76258627 GGGAAGGGTAAAGCAAAGAGAGG - Intronic
1072631949 10:97152282-97152304 GGGAAGGTCCCTGCAAATTGAGG + Intronic
1073997115 10:109328243-109328265 GGGAAGCTTAGTGCCAATGGAGG + Intergenic
1076200558 10:128554441-128554463 GGGTGGGTTAATGTAAACTGAGG + Intergenic
1077983112 11:7321762-7321784 GGGCGGGTTAATGCAAATAGAGG + Intronic
1080463195 11:32473562-32473584 GGGCAGGTCAATGCAAACTGAGG - Intergenic
1081368269 11:42264065-42264087 AGGCAGATTAATGCCAATTGTGG - Intergenic
1087343972 11:96946011-96946033 AGTAAACTTAATGCAAATTGTGG + Intergenic
1087682093 11:101229718-101229740 TTGAAGGTAAAGGCAAATTGTGG + Intergenic
1088224510 11:107604895-107604917 AGGAAAGTTCAGGCAAATTGGGG - Intronic
1090159931 11:124481997-124482019 CGGGAGGTTAATGGAAATTAAGG + Intergenic
1093876322 12:24353492-24353514 GGGAAAGAGAATGCAAAGTGAGG + Intergenic
1093941401 12:25058890-25058912 GCAAAGGTGAATGCAAATTGTGG + Intronic
1094475959 12:30840744-30840766 GGATGGGTCAATGCAAATTGAGG + Intergenic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1097021147 12:56021569-56021591 GGGAAGGATAATGTAAGTTCAGG + Exonic
1098012371 12:66067042-66067064 GGGATGGTTAAAGGAACTTGGGG + Intergenic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1106657871 13:31766657-31766679 GGGATTGTTCATGAAAATTGTGG - Intronic
1107095828 13:36534044-36534066 GGGCAGGTTGCTGCAGATTGTGG + Intergenic
1107582880 13:41810622-41810644 GGGAAGGGTAGTGAGAATTGGGG + Intronic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1109411856 13:61980824-61980846 AGGAAATTTAATGCAAAATGAGG - Intergenic
1110497055 13:76180350-76180372 GGGCAGATTAATGCAAATTGAGG - Intergenic
1111179599 13:84645781-84645803 GGGTGGATCAATGCAAATTGAGG + Intergenic
1111657548 13:91173026-91173048 GGAAAAGTGAATGCAAATTAAGG + Intergenic
1111663843 13:91243233-91243255 GGGTAGGTTGATACAAATTGAGG + Intergenic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112582487 13:100688435-100688457 GGGCAGATTAATGCACATTGGGG + Intergenic
1112583574 13:100697167-100697189 GAGTGGGTTAATGCAAATTTGGG + Intergenic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1112966093 13:105196055-105196077 GGTCAGGCTAATACAAATTGAGG + Intergenic
1114948929 14:27722415-27722437 GTGAAGCTTAAAGCAAATTATGG + Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1116866697 14:50037288-50037310 GGGAAGCCTAATGCAGACTGAGG - Intergenic
1120187649 14:81411113-81411135 GAGAAGGTTAAGGAAAATTTTGG + Intronic
1120246960 14:82018786-82018808 GGGAAGATCAATACAAATTTTGG - Intergenic
1121513993 14:94536843-94536865 GGGCAGTTTAGTGCAAATTGAGG + Intergenic
1123393601 15:19901509-19901531 GGAAAGTGTAATGCAAAATGTGG + Intergenic
1123835205 15:24182977-24182999 GGGCAAGTCAAGGCAAATTGAGG + Intergenic
1123849961 15:24344332-24344354 GGGGCAGTCAATGCAAATTGAGG + Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG + Intergenic
1126942386 15:53780869-53780891 GGGCACGTTAATGCAAAAGGCGG + Intergenic
1127136714 15:55931906-55931928 GGGAAGGTTGAGGGAAAATGGGG - Intronic
1127163110 15:56212480-56212502 GTGAAGCTTAATGTAAATTATGG + Intronic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1131849112 15:96518862-96518884 GGAAAGGTCAAGGAAAATTGGGG + Intergenic
1132436825 15:101812997-101813019 AGGAAGGCTAAAGCAAATTGAGG + Intronic
1133475235 16:6114968-6114990 GGACAAGTTAATGCAAACTGAGG + Intronic
1133512583 16:6474053-6474075 GGGCTGGTTACTGCAAACTGTGG + Intronic
1133776089 16:8896300-8896322 GGAAAGGTTTATGCAACTTTCGG - Intronic
1134908308 16:18001012-18001034 GGGAAGGATTATGCTAATCGGGG - Intergenic
1135861011 16:26056124-26056146 GGGGAAGTTAATTCAAATGGAGG - Intronic
1136695955 16:32082309-32082331 GGAAAGTGTAATGCAAAATGTGG - Intergenic
1136699604 16:32118877-32118899 GGAAAGTGTAATGCAAAATGTGG + Intergenic
1136768054 16:32809044-32809066 GGAAAGTGTAATGCAAAATGTGG - Intergenic
1136771308 16:32844023-32844045 GGGAAAGGTAATGCAAAATGTGG - Intergenic
1136796450 16:33025562-33025584 GGAAAGTGTAATGCAAAATGTGG - Intergenic
1136800097 16:33062053-33062075 GGGAAGTGTAATGCAAAATGTGG + Intergenic
1136868247 16:33773201-33773223 GGAAAGTGTAATGCAAAATGTGG + Intergenic
1136899268 16:34017430-34017452 GGGAAGTGTAATGCAAAATGTGG + Intergenic
1136902497 16:34053317-34053339 GGGAAGCGTAATGCAAAATGCGG + Intergenic
1136957995 16:34806063-34806085 GGAAAGTGTAATGCAAAATGTGG + Intergenic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1139102900 16:63789611-63789633 GGGATGATCAATGCAAATTGTGG + Intergenic
1139183996 16:64782191-64782213 GTGAATCTTAATGCAAACTGTGG - Intergenic
1141334832 16:83144905-83144927 GGGTAGGTTAATGGAGACTGAGG + Intronic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1203070444 16_KI270728v1_random:1071064-1071086 GGAAAGTGTAATGCAAAATGTGG - Intergenic
1203073733 16_KI270728v1_random:1106133-1106155 GGGAAAGGTAATGCAAAATGTGG - Intergenic
1203103927 16_KI270728v1_random:1343075-1343097 GGAAAGTGTAATGCAAACTGTGG - Intergenic
1203129587 16_KI270728v1_random:1619293-1619315 GGAAAGTGTAATGCAAACTGTGG + Intergenic
1144424856 17:15132285-15132307 GGGTGGGTCAATTCAAATTGAGG - Intergenic
1145710289 17:26965073-26965095 GGAAAGTGTAATGCAAAATGTGG + Intergenic
1145767022 17:27465583-27465605 GGAAAGTGTAATGCAAAATGTGG + Intronic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1149722712 17:58862433-58862455 GGGAAAATTATTTCAAATTGGGG - Intronic
1151638357 17:75369237-75369259 GGGTAAGTTGATGCAAAATGAGG - Intronic
1151905465 17:77045611-77045633 GGGTTGGTTAATGCAGAGTGAGG - Intergenic
1152876242 17:82787891-82787913 ATTAAGATTAATGCAAATTGAGG + Intronic
1154517961 18:15195570-15195592 GGAAAGTGTAATGCAAAATGTGG - Intergenic
1155523941 18:26697561-26697583 GGGTGGGTCAATGCAATTTGAGG + Intergenic
1159025045 18:63175982-63176004 GGGAAGGTGGGTGAAAATTGTGG + Intronic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1159184449 18:64950445-64950467 GTGTAGGTTAATGCCAATTAAGG + Intergenic
1160471577 18:79139813-79139835 GGGAAGGTTAGTGGGAGTTGTGG - Intronic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1165134738 19:33660703-33660725 AGGCAGGTTAATGCAAATCAAGG - Intronic
1167799096 19:51728756-51728778 GGGAAGGGAAATGCACACTGCGG + Intergenic
1202679862 1_KI270712v1_random:490-512 GGAAAGTGTAATGCAAAATGTGG - Intergenic
927027856 2:19088751-19088773 GGCAAGATTAAAGCAAATTGAGG - Intergenic
927209768 2:20631914-20631936 GGGCAGGTTACTGCAGACTGTGG - Intronic
929327714 2:40637314-40637336 CAGATGGTTAATGGAAATTGAGG - Intergenic
930683221 2:54279989-54280011 GGGAAGATAAATGCAAGTTGTGG + Intronic
930863709 2:56102497-56102519 GGGTGGGCCAATGCAAATTGAGG - Intergenic
931202593 2:60113399-60113421 GGAAAGATGAATGCAAAGTGAGG - Intergenic
931965433 2:67528671-67528693 GTGCAGGTTAATGCAAATTGAGG - Intergenic
933081330 2:77990568-77990590 GGGAAGGTTAAAGGTAATTTAGG + Intergenic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
934251249 2:90357837-90357859 GGAAAGTATAATGCAAAATGTGG - Intergenic
934258311 2:91445564-91445586 GGAAAGTATAATGCAAAATGTGG + Intergenic
935152329 2:100449310-100449332 GGGAAGGTGAAGGGAAATTAAGG - Intergenic
936285066 2:111175383-111175405 GAGAAGGATAAAGCAAAATGTGG + Intergenic
938517878 2:132035804-132035826 GGAAAGTGTAATGCAAAATGTGG - Intergenic
940748452 2:157597212-157597234 GGGCAGGTTAATGCACATGCAGG - Intronic
947770612 2:232667359-232667381 TGGAAGGATAATGCAATGTGGGG + Intronic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1169884856 20:10387991-10388013 GGGAATGTTAATGTAAATAGTGG + Intergenic
1170036133 20:11992184-11992206 GGGAAGGCCAAGGCAAATGGGGG - Intergenic
1170478788 20:16744448-16744470 GGGAGGCTCAATACAAATTGAGG + Intergenic
1171325011 20:24283460-24283482 GGGCAGGTCAATACAAATTAAGG + Intergenic
1172554278 20:35827366-35827388 GGGAAAGTTAAGTCAAATTCTGG + Intronic
1172570708 20:35968166-35968188 GGGCAGGCTAATGCAAATTAAGG + Intronic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1173308103 20:41871170-41871192 GAACAGGTCAATGCAAATTGAGG - Intergenic
1173702287 20:45083369-45083391 GGGCAGGTTACTGCAGGTTGTGG + Intergenic
1173933562 20:46841798-46841820 GGAAAAGTTATTACAAATTGTGG - Intergenic
1175203038 20:57291047-57291069 AGGAAGGTGGATGCAAAATGGGG - Intergenic
1175375892 20:58523801-58523823 GCCAAGGTAAATGCAAGTTGGGG + Intergenic
1175907104 20:62386424-62386446 GGGAAGCAGAATGCAAACTGGGG - Intergenic
1176386535 21:6140916-6140938 TGGAAGTTTACTGCAAACTGGGG + Intergenic
1176583651 21:8552697-8552719 GGAAAGTGTAATGCAAAATGTGG + Intergenic
1177151905 21:17463721-17463743 GGGAAGATTAATTCCAACTGGGG + Intergenic
1177963315 21:27696280-27696302 GAGAAGGTTAAGGAGAATTGAGG + Intergenic
1178026796 21:28477635-28477657 GGGTGAGGTAATGCAAATTGAGG - Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1178704020 21:34858146-34858168 GGGAAAGTTGATGCAGCTTGGGG + Intronic
1179117913 21:38511110-38511132 AGGAAGGTTATTGAAAATTCAGG - Intronic
1179736938 21:43397336-43397358 TGGAAGTTTACTGCAAACTGGGG - Intergenic
1180266461 22:10529630-10529652 GGAAAGTGTAATGCAAAATGTGG + Intergenic
1184686465 22:46098572-46098594 GTGAATGTTGATGAAAATTGGGG + Intronic
1184740066 22:46422890-46422912 GGGAAGAAGAATGCAAAGTGAGG - Intronic
1203235858 22_KI270732v1_random:551-573 GGAAAGTGTAATGCAAAATGTGG + Intergenic
950779379 3:15378222-15378244 GGGCAAGCTGATGCAAATTGAGG + Intergenic
957361933 3:79172126-79172148 GGGAGGCTTAGAGCAAATTGAGG - Intronic
958050575 3:88339203-88339225 GGGAAGGGTAATGGGAACTGGGG - Intergenic
958492267 3:94792406-94792428 GAAAAGGGTAATGCAAATGGTGG - Intergenic
959770636 3:110090911-110090933 GGGCAAGTCAATGCAAATTGAGG + Intergenic
964629524 3:158795005-158795027 GGGAAAGTGAAAGCAATTTGGGG - Intronic
967507817 3:190272936-190272958 GGGCAGGTTGCTGCAAATCGTGG + Intergenic
969218466 4:5743014-5743036 GGGCAGTTCATTGCAAATTGAGG + Intronic
971409583 4:26355864-26355886 GGGATGGTTAATTCAGACTGGGG + Intronic
971584184 4:28383864-28383886 TTGAAGGTTATTGTAAATTGGGG + Intronic
972441653 4:39099383-39099405 GGGGAGATCAATGCATATTGAGG - Intronic
974304952 4:60124151-60124173 GTGAATGTTTAAGCAAATTGTGG + Intergenic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
975586059 4:75950555-75950577 AGGAATGTTAATGTAAATAGTGG - Exonic
975643984 4:76527956-76527978 GGGAGGGTGAATGGATATTGGGG + Intronic
976775609 4:88702926-88702948 GGGCAGGTTGCTGCAGATTGTGG - Intronic
976985155 4:91285443-91285465 GGTAAGTTTAATTCAAATTAAGG - Intronic
978705667 4:111707231-111707253 GGGAAACTTTATGTAAATTGTGG - Intergenic
978873502 4:113608939-113608961 GTTAAGGTTAATTCAAATTAAGG + Intronic
980340170 4:131534326-131534348 TTAAAGGTTAATTCAAATTGTGG - Intergenic
980771535 4:137379583-137379605 GGGAAATTTAATGCCAATTTAGG - Intergenic
981176803 4:141691694-141691716 GGGCAGGCTAATGCAAAGGGTGG + Intronic
981376145 4:144018237-144018259 GGGAACATTAAGGCAAATTAAGG - Intronic
982301672 4:153885053-153885075 GGAAAAGTTAATGAAAATAGAGG - Intergenic
982625613 4:157762255-157762277 GGAAAGCTGAATGCAAATTTGGG - Intergenic
983166823 4:164487849-164487871 AGGAATGTTAATGAAAATTTTGG + Intergenic
983811829 4:172072083-172072105 GGGCAGGTTGCTGCAGATTGTGG + Intronic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
985700465 5:1368840-1368862 GGACAGGTCAATGCAAATTAAGG - Intergenic
986209495 5:5657345-5657367 GGTGGGGTTATTGCAAATTGAGG - Intergenic
990715336 5:58629973-58629995 GGGAAGGTTGCTGCAGGTTGTGG + Intronic
990746820 5:58967062-58967084 GGGAATCATAATGCCAATTGTGG + Intergenic
992558742 5:77929361-77929383 GGGAAGGGCAATGCAGTTTGGGG + Intergenic
993032626 5:82723013-82723035 GGGAAGGTGGATGTAAAATGCGG + Intergenic
994733108 5:103517740-103517762 GGGAAAGTTAAGGCATATGGGGG + Intergenic
994834546 5:104832508-104832530 GGGAAGGTTTATGCAAAGAAAGG - Intergenic
994842110 5:104937909-104937931 GGAAATATTAATGCAAATTGAGG - Intergenic
995400878 5:111739822-111739844 GTGAAGATTAATGCAAACTTTGG - Intronic
996870519 5:128187178-128187200 GGGCAGGTTAATCAAAAATGGGG + Exonic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
997523223 5:134536584-134536606 AGGGAGGTTTATGCAAAGTGAGG + Intronic
998323082 5:141250943-141250965 AGGTGAGTTAATGCAAATTGAGG - Intergenic
998740892 5:145199996-145200018 GGGAAGATTAATGAAAAATGAGG - Intergenic
999036577 5:148358165-148358187 GGGAAGGGTAATGACAATGGTGG - Intergenic
999927539 5:156395535-156395557 GGGAAGGTTGCTGCATTTTGTGG + Intronic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1004684594 6:17930628-17930650 GGGAAGGTTATGGCAAAGTGTGG - Intronic
1005954279 6:30652771-30652793 AGAAAGGTTAATGCCAGTTGGGG - Intronic
1005992403 6:30911529-30911551 GGGAAGGGGAAAGCAAGTTGTGG + Intronic
1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG + Intergenic
1006278889 6:33030212-33030234 GGGAAGGTGAAAGAAACTTGGGG - Intergenic
1007085688 6:39143122-39143144 GGGAACGTTAATTCTAATTAAGG + Intergenic
1007682791 6:43645706-43645728 GGGAAGGTTTCTGGAAAATGCGG + Intronic
1008068292 6:47073865-47073887 GGAAAGGTAAGTGCAATTTGGGG + Intergenic
1008756796 6:54805614-54805636 GGGAATATTAATGCCAAATGTGG + Intergenic
1009370476 6:62894376-62894398 GTGTGGATTAATGCAAATTGAGG + Intergenic
1010616605 6:78020566-78020588 GGGCAGGTTAATATGAATTGAGG - Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1011545406 6:88477438-88477460 GGGTGGGTTAATGCAAATCAAGG + Intergenic
1014480363 6:121928372-121928394 GGGCTGATTAATGCTAATTGTGG - Intergenic
1016519575 6:144931464-144931486 AGGCAGGTCAATGCAAATTGAGG + Intergenic
1018623260 6:165751802-165751824 GGACAGGTGCATGCAAATTGAGG - Intronic
1019904459 7:4050258-4050280 AGTAAGTTGAATGCAAATTGTGG - Intronic
1019954337 7:4401433-4401455 GGGTAGGTCAATGCAAGCTGAGG + Intergenic
1021892186 7:25196551-25196573 GGGAAGCTAAATGCAAACTCAGG - Intergenic
1022084337 7:27051767-27051789 AGGAATGTTAAAGCAAATTATGG + Intergenic
1022494141 7:30842807-30842829 GGGAAGGTGAAAACAATTTGAGG - Intronic
1023933455 7:44722015-44722037 CTGAAGGTTTAAGCAAATTGTGG - Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1025840729 7:65143373-65143395 GGAAAGTGTAATGCAAAATGTGG + Intergenic
1025882321 7:65552584-65552606 GGAAAGTGTAATGCAAAATGTGG - Intergenic
1025891121 7:65650018-65650040 GGAAAGTGTAATGCAAAATGTGG + Intergenic
1027534808 7:79385014-79385036 TGGAAGGTTAAAGAAAATGGGGG + Intronic
1028035407 7:85975474-85975496 GGGCAGCTCAATGCAAAGTGAGG + Intergenic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1030173137 7:106625039-106625061 GGGAAGTTAAATGCATATTTAGG + Intergenic
1030654814 7:112155385-112155407 GGGAAGGGTAAACCAAAATGGGG - Intronic
1031475195 7:122212606-122212628 GGGACGGTAAATGTAAATGGGGG + Intergenic
1031541001 7:122994419-122994441 GGGAAGGTTAAAGTAATGTGTGG + Intergenic
1031813397 7:126401440-126401462 GTGAAGGTTAAAGAAAACTGTGG - Intergenic
1033643513 7:143284692-143284714 GGAAAGGTTAATGCTAACTCCGG + Intronic
1034078178 7:148252370-148252392 GGAAAGGTTGGTGAAAATTGTGG - Intronic
1038139888 8:24833021-24833043 GGGAAGATTAATAGAAAATGAGG + Intergenic
1038303637 8:26379191-26379213 GGAAATGTTAATGTAAATAGTGG - Intergenic
1038375206 8:27033164-27033186 GGGTAGGTTAATATGAATTGAGG + Intergenic
1038518941 8:28212627-28212649 GGGAAGGATTATACAAATTATGG + Intergenic
1039684070 8:39777531-39777553 GGGAAGGGTAGTACAAAGTGGGG + Intronic
1039790610 8:40872760-40872782 GGGATGGTTGATGCCAATTGGGG + Intronic
1041777243 8:61536830-61536852 GGGCAGGTTACTGCAGGTTGTGG + Intronic
1041853983 8:62427989-62428011 GGGAAGGGTAATGGCAAGTGGGG - Intronic
1042064539 8:64859340-64859362 GGGGAGGTTAATCTGAATTGGGG - Intergenic
1042501255 8:69511730-69511752 GTGAAAGCTAATGTAAATTGTGG - Intronic
1042990862 8:74638146-74638168 GGGATGGTTGATGGAAGTTGGGG + Intronic
1045288943 8:100815584-100815606 GGGCAGTTTAATGTAAGTTGGGG - Intergenic
1048397149 8:134024614-134024636 GAGAAGGGTAAAGCAAAATGGGG - Intergenic
1050584132 9:7092450-7092472 GGTCAGATTAATGCAAAATGAGG - Intergenic
1052245434 9:26328603-26328625 GGGGTGGTTAATTCAAATTTGGG - Intergenic
1054962470 9:70983931-70983953 GGGGTGGTTACTGCAGATTGTGG + Intronic
1055079494 9:72255226-72255248 GGGTGGGTGGATGCAAATTGAGG + Intronic
1055538637 9:77277448-77277470 GTGAACCTTAATGTAAATTGTGG - Intronic
1062074353 9:134576425-134576447 AGAAAGGTAAATGCAATTTGAGG + Intergenic
1203613606 Un_KI270749v1:30465-30487 GGGAAGTGTAATGCAAAATGTGG + Intergenic
1187126154 X:16456273-16456295 GGGAAGGTGAGTGCAAAGAGAGG + Intergenic
1190364636 X:49680108-49680130 GGGTCAGTCAATGCAAATTGAGG + Intergenic
1190396432 X:49989803-49989825 ATGAATGTTAATGGAAATTGGGG - Intronic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190628399 X:52359930-52359952 GGGCGGGTTAATGCAAATTTAGG - Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1191973829 X:66848142-66848164 GGGAAGGGTAATAGAAAATGGGG + Intergenic
1193515653 X:82459259-82459281 GGGAAGCTTGATGCTAATTAAGG + Intergenic
1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1195346943 X:103960290-103960312 GGGAAGGTGAATGGAAGTGGAGG + Intronic
1195360499 X:104078551-104078573 GGGAAGGTGAATGGAAGTGGAGG - Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1198212237 X:134527099-134527121 TGGAGGGTGAATGCAAAATGAGG - Intergenic
1198441367 X:136666612-136666634 GGGAAGGTCACTGGAAATTGAGG - Exonic
1198488860 X:137117712-137117734 GGGAAGGTTAAGGTGAAGTGGGG + Intergenic
1199561899 X:149172194-149172216 GGGCATGATAATGCAAATGGTGG + Intergenic
1200499133 Y:3922441-3922463 GGGGTGGTCAATGCAAATTGAGG + Intergenic