ID: 1138784246

View in Genome Browser
Species Human (GRCh38)
Location 16:59827691-59827713
Sequence TTGGTAGAATAACCATTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138784246_1138784249 0 Left 1138784246 16:59827691-59827713 CCTCCTAATGGTTATTCTACCAA No data
Right 1138784249 16:59827714-59827736 CAAGACAAATGTACTCATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138784246 Original CRISPR TTGGTAGAATAACCATTAGG AGG (reversed) Intergenic
No off target data available for this crispr