ID: 1138794434

View in Genome Browser
Species Human (GRCh38)
Location 16:59950954-59950976
Sequence AGTCCCCAAGGAAAAGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138794432_1138794434 -4 Left 1138794432 16:59950935-59950957 CCTCTTGGATTTAAGGAAGAGTC No data
Right 1138794434 16:59950954-59950976 AGTCCCCAAGGAAAAGAAGTAGG No data
1138794431_1138794434 -3 Left 1138794431 16:59950934-59950956 CCCTCTTGGATTTAAGGAAGAGT No data
Right 1138794434 16:59950954-59950976 AGTCCCCAAGGAAAAGAAGTAGG No data
1138794427_1138794434 21 Left 1138794427 16:59950910-59950932 CCAAAGGTTGTGCACTCTGGCCA No data
Right 1138794434 16:59950954-59950976 AGTCCCCAAGGAAAAGAAGTAGG No data
1138794430_1138794434 1 Left 1138794430 16:59950930-59950952 CCAACCCTCTTGGATTTAAGGAA No data
Right 1138794434 16:59950954-59950976 AGTCCCCAAGGAAAAGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138794434 Original CRISPR AGTCCCCAAGGAAAAGAAGT AGG Intergenic