ID: 1138796584

View in Genome Browser
Species Human (GRCh38)
Location 16:59976902-59976924
Sequence GTGCCGTTTTTTAAGCTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138796584_1138796590 8 Left 1138796584 16:59976902-59976924 CCGACCAGCTTAAAAAACGGCAC No data
Right 1138796590 16:59976933-59976955 ATTATATCCCGCACCTGGCTCGG 0: 636
1: 1265
2: 1149
3: 581
4: 360
1138796584_1138796592 12 Left 1138796584 16:59976902-59976924 CCGACCAGCTTAAAAAACGGCAC No data
Right 1138796592 16:59976937-59976959 TATCCCGCACCTGGCTCGGAGGG 0: 496
1: 1490
2: 1803
3: 1148
4: 796
1138796584_1138796589 3 Left 1138796584 16:59976902-59976924 CCGACCAGCTTAAAAAACGGCAC No data
Right 1138796589 16:59976928-59976950 ATGGGATTATATCCCGCACCTGG No data
1138796584_1138796596 26 Left 1138796584 16:59976902-59976924 CCGACCAGCTTAAAAAACGGCAC No data
Right 1138796596 16:59976951-59976973 CTCGGAGGGTCCTGTGCGCACGG No data
1138796584_1138796591 11 Left 1138796584 16:59976902-59976924 CCGACCAGCTTAAAAAACGGCAC No data
Right 1138796591 16:59976936-59976958 ATATCCCGCACCTGGCTCGGAGG 0: 494
1: 1487
2: 1828
3: 1188
4: 779

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138796584 Original CRISPR GTGCCGTTTTTTAAGCTGGT CGG (reversed) Intergenic
No off target data available for this crispr