ID: 1138798170

View in Genome Browser
Species Human (GRCh38)
Location 16:59994498-59994520
Sequence GGAAACTCCCAAGCCAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138798167_1138798170 9 Left 1138798167 16:59994466-59994488 CCTAGGAAGTGGACCTTTCAGTA No data
Right 1138798170 16:59994498-59994520 GGAAACTCCCAAGCCAAACCAGG No data
1138798169_1138798170 -4 Left 1138798169 16:59994479-59994501 CCTTTCAGTATTAAATGCTGGAA No data
Right 1138798170 16:59994498-59994520 GGAAACTCCCAAGCCAAACCAGG No data
1138798164_1138798170 27 Left 1138798164 16:59994448-59994470 CCTGGAACTGAGGAGGTTCCTAG No data
Right 1138798170 16:59994498-59994520 GGAAACTCCCAAGCCAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138798170 Original CRISPR GGAAACTCCCAAGCCAAACC AGG Intergenic
No off target data available for this crispr