ID: 1138802178

View in Genome Browser
Species Human (GRCh38)
Location 16:60046943-60046965
Sequence ATGCATAAACAGATTTTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138802177_1138802178 -8 Left 1138802177 16:60046928-60046950 CCATTGGTATTAACGATGCATAA No data
Right 1138802178 16:60046943-60046965 ATGCATAAACAGATTTTGCTTGG No data
1138802176_1138802178 -7 Left 1138802176 16:60046927-60046949 CCCATTGGTATTAACGATGCATA No data
Right 1138802178 16:60046943-60046965 ATGCATAAACAGATTTTGCTTGG No data
1138802174_1138802178 9 Left 1138802174 16:60046911-60046933 CCATGATGAAATGAGTCCCATTG No data
Right 1138802178 16:60046943-60046965 ATGCATAAACAGATTTTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138802178 Original CRISPR ATGCATAAACAGATTTTGCT TGG Intergenic
No off target data available for this crispr