ID: 1138812794

View in Genome Browser
Species Human (GRCh38)
Location 16:60170772-60170794
Sequence CTTTCAAGACAGAAGGAATA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138812792_1138812794 28 Left 1138812792 16:60170721-60170743 CCTGGAGTGTGAGACAACTTAAG No data
Right 1138812794 16:60170772-60170794 CTTTCAAGACAGAAGGAATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138812794 Original CRISPR CTTTCAAGACAGAAGGAATA CGG Intergenic
No off target data available for this crispr