ID: 1138820540

View in Genome Browser
Species Human (GRCh38)
Location 16:60254064-60254086
Sequence GTGGATTTTCCCTTTTAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138820540_1138820550 22 Left 1138820540 16:60254064-60254086 CCCCCCTAAAAGGGAAAATCCAC No data
Right 1138820550 16:60254109-60254131 CCACAGTGTACCTGACTGCAGGG No data
1138820540_1138820548 21 Left 1138820540 16:60254064-60254086 CCCCCCTAAAAGGGAAAATCCAC No data
Right 1138820548 16:60254108-60254130 TCCACAGTGTACCTGACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138820540 Original CRISPR GTGGATTTTCCCTTTTAGGG GGG (reversed) Intergenic
No off target data available for this crispr