ID: 1138845186

View in Genome Browser
Species Human (GRCh38)
Location 16:60556414-60556436
Sequence GGAAAATGGGCTTCATGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138845186_1138845190 12 Left 1138845186 16:60556414-60556436 CCATTGCATGAAGCCCATTTTCC No data
Right 1138845190 16:60556449-60556471 TTGCTCAGACTGCAGCAGCCTGG No data
1138845186_1138845191 23 Left 1138845186 16:60556414-60556436 CCATTGCATGAAGCCCATTTTCC No data
Right 1138845191 16:60556460-60556482 GCAGCAGCCTGGCATCATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138845186 Original CRISPR GGAAAATGGGCTTCATGCAA TGG (reversed) Intergenic
No off target data available for this crispr