ID: 1138852758

View in Genome Browser
Species Human (GRCh38)
Location 16:60649955-60649977
Sequence AGGACTTTCTCTAGGCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138852758_1138852762 -6 Left 1138852758 16:60649955-60649977 CCCTCTAGCCTAGAGAAAGTCCT No data
Right 1138852762 16:60649972-60649994 AGTCCTTTACCCATGGAGCTCGG No data
1138852758_1138852763 -5 Left 1138852758 16:60649955-60649977 CCCTCTAGCCTAGAGAAAGTCCT No data
Right 1138852763 16:60649973-60649995 GTCCTTTACCCATGGAGCTCGGG No data
1138852758_1138852764 -4 Left 1138852758 16:60649955-60649977 CCCTCTAGCCTAGAGAAAGTCCT No data
Right 1138852764 16:60649974-60649996 TCCTTTACCCATGGAGCTCGGGG No data
1138852758_1138852770 27 Left 1138852758 16:60649955-60649977 CCCTCTAGCCTAGAGAAAGTCCT No data
Right 1138852770 16:60650005-60650027 CATCACCATTTCATTTGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138852758 Original CRISPR AGGACTTTCTCTAGGCTAGA GGG (reversed) Intergenic