ID: 1138852758 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:60649955-60649977 |
| Sequence | AGGACTTTCTCTAGGCTAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1138852758_1138852762 | -6 | Left | 1138852758 | 16:60649955-60649977 | CCCTCTAGCCTAGAGAAAGTCCT | No data | ||
| Right | 1138852762 | 16:60649972-60649994 | AGTCCTTTACCCATGGAGCTCGG | No data | ||||
| 1138852758_1138852763 | -5 | Left | 1138852758 | 16:60649955-60649977 | CCCTCTAGCCTAGAGAAAGTCCT | No data | ||
| Right | 1138852763 | 16:60649973-60649995 | GTCCTTTACCCATGGAGCTCGGG | No data | ||||
| 1138852758_1138852764 | -4 | Left | 1138852758 | 16:60649955-60649977 | CCCTCTAGCCTAGAGAAAGTCCT | No data | ||
| Right | 1138852764 | 16:60649974-60649996 | TCCTTTACCCATGGAGCTCGGGG | No data | ||||
| 1138852758_1138852770 | 27 | Left | 1138852758 | 16:60649955-60649977 | CCCTCTAGCCTAGAGAAAGTCCT | No data | ||
| Right | 1138852770 | 16:60650005-60650027 | CATCACCATTTCATTTGTAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1138852758 | Original CRISPR | AGGACTTTCTCTAGGCTAGA GGG (reversed) | Intergenic | ||