ID: 1138857848

View in Genome Browser
Species Human (GRCh38)
Location 16:60716194-60716216
Sequence CTGTAAACACAGATTTTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138857848_1138857851 13 Left 1138857848 16:60716194-60716216 CCTTTCAAAATCTGTGTTTACAG No data
Right 1138857851 16:60716230-60716252 TGTTTTGCTCTGACCATCCTGGG No data
1138857848_1138857850 12 Left 1138857848 16:60716194-60716216 CCTTTCAAAATCTGTGTTTACAG No data
Right 1138857850 16:60716229-60716251 CTGTTTTGCTCTGACCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138857848 Original CRISPR CTGTAAACACAGATTTTGAA AGG (reversed) Intergenic
No off target data available for this crispr