ID: 1138858456

View in Genome Browser
Species Human (GRCh38)
Location 16:60724539-60724561
Sequence AGAAGGCATCTGGAAGATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138858453_1138858456 2 Left 1138858453 16:60724514-60724536 CCTCATAATATTTAATAGAGGCA No data
Right 1138858456 16:60724539-60724561 AGAAGGCATCTGGAAGATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138858456 Original CRISPR AGAAGGCATCTGGAAGATCT AGG Intergenic
No off target data available for this crispr