ID: 1138862811

View in Genome Browser
Species Human (GRCh38)
Location 16:60778616-60778638
Sequence CAAACTTGACCCTTTTATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138862810_1138862811 2 Left 1138862810 16:60778591-60778613 CCTTAATTGGTAAAAGTTCGAAG No data
Right 1138862811 16:60778616-60778638 CAAACTTGACCCTTTTATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138862811 Original CRISPR CAAACTTGACCCTTTTATCT TGG Intergenic
No off target data available for this crispr