ID: 1138864690

View in Genome Browser
Species Human (GRCh38)
Location 16:60802440-60802462
Sequence TTTTGGGATACATCCATGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138864690_1138864694 -3 Left 1138864690 16:60802440-60802462 CCAGACATGGATGTATCCCAAAA No data
Right 1138864694 16:60802460-60802482 AAAAGGTCATTATGAGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138864690 Original CRISPR TTTTGGGATACATCCATGTC TGG (reversed) Intergenic
No off target data available for this crispr