ID: 1138867755

View in Genome Browser
Species Human (GRCh38)
Location 16:60844313-60844335
Sequence ACTCGCTCACCTCTATCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138867753_1138867755 1 Left 1138867753 16:60844289-60844311 CCTATAGGAACTCACAGAGTGAG No data
Right 1138867755 16:60844313-60844335 ACTCGCTCACCTCTATCCCAGGG No data
1138867751_1138867755 18 Left 1138867751 16:60844272-60844294 CCTTTCAACAATCAGCTCCTATA No data
Right 1138867755 16:60844313-60844335 ACTCGCTCACCTCTATCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138867755 Original CRISPR ACTCGCTCACCTCTATCCCA GGG Intergenic
No off target data available for this crispr