ID: 1138869085

View in Genome Browser
Species Human (GRCh38)
Location 16:60859212-60859234
Sequence TTGGGGAAGTTACAGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138869085_1138869091 2 Left 1138869085 16:60859212-60859234 CCTTCCAACTGTAACTTCCCCAA No data
Right 1138869091 16:60859237-60859259 TGTGTAGTGGTTACTAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138869085 Original CRISPR TTGGGGAAGTTACAGTTGGA AGG (reversed) Intergenic
No off target data available for this crispr