ID: 1138870234

View in Genome Browser
Species Human (GRCh38)
Location 16:60874442-60874464
Sequence TATCTCTAGCACTCACAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138870227_1138870234 12 Left 1138870227 16:60874407-60874429 CCGCTCAGTGTTACTTTCTGAGG No data
Right 1138870234 16:60874442-60874464 TATCTCTAGCACTCACAGGTGGG No data
1138870226_1138870234 13 Left 1138870226 16:60874406-60874428 CCCGCTCAGTGTTACTTTCTGAG No data
Right 1138870234 16:60874442-60874464 TATCTCTAGCACTCACAGGTGGG No data
1138870225_1138870234 16 Left 1138870225 16:60874403-60874425 CCTCCCGCTCAGTGTTACTTTCT No data
Right 1138870234 16:60874442-60874464 TATCTCTAGCACTCACAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138870234 Original CRISPR TATCTCTAGCACTCACAGGT GGG Intergenic
No off target data available for this crispr