ID: 1138878199

View in Genome Browser
Species Human (GRCh38)
Location 16:60978985-60979007
Sequence GTGCATCACCACCAATGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138878198_1138878199 18 Left 1138878198 16:60978944-60978966 CCTGAATTATATAATCTAATATA No data
Right 1138878199 16:60978985-60979007 GTGCATCACCACCAATGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138878199 Original CRISPR GTGCATCACCACCAATGAAA TGG Intergenic
No off target data available for this crispr