ID: 1138878705

View in Genome Browser
Species Human (GRCh38)
Location 16:60984161-60984183
Sequence GAGAACAAAATGAAAACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138878701_1138878705 27 Left 1138878701 16:60984111-60984133 CCTGGCATTAATGTCTCTACTCT No data
Right 1138878705 16:60984161-60984183 GAGAACAAAATGAAAACTGCAGG No data
1138878704_1138878705 -6 Left 1138878704 16:60984144-60984166 CCTGGAACAAGAAGAAAGAGAAC No data
Right 1138878705 16:60984161-60984183 GAGAACAAAATGAAAACTGCAGG No data
1138878703_1138878705 -1 Left 1138878703 16:60984139-60984161 CCACTCCTGGAACAAGAAGAAAG No data
Right 1138878705 16:60984161-60984183 GAGAACAAAATGAAAACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138878705 Original CRISPR GAGAACAAAATGAAAACTGC AGG Intergenic
No off target data available for this crispr