ID: 1138884904

View in Genome Browser
Species Human (GRCh38)
Location 16:61064866-61064888
Sequence GTCCATCATTATGGGCATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138884904_1138884909 -5 Left 1138884904 16:61064866-61064888 CCCAAATGCCCATAATGATGGAC No data
Right 1138884909 16:61064884-61064906 TGGACTGGATAAAGAAAATGTGG 0: 560
1: 8181
2: 27146
3: 13153
4: 9954
1138884904_1138884910 11 Left 1138884904 16:61064866-61064888 CCCAAATGCCCATAATGATGGAC No data
Right 1138884910 16:61064900-61064922 AATGTGGCTCATATACATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138884904 Original CRISPR GTCCATCATTATGGGCATTT GGG (reversed) Intergenic
No off target data available for this crispr