ID: 1138884907

View in Genome Browser
Species Human (GRCh38)
Location 16:61064874-61064896
Sequence TTTATCCAGTCCATCATTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34835
Summary {0: 2, 1: 25, 2: 687, 3: 18256, 4: 15865}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138884907_1138884910 3 Left 1138884907 16:61064874-61064896 CCCATAATGATGGACTGGATAAA 0: 2
1: 25
2: 687
3: 18256
4: 15865
Right 1138884910 16:61064900-61064922 AATGTGGCTCATATACATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138884907 Original CRISPR TTTATCCAGTCCATCATTAT GGG (reversed) Intergenic
Too many off-targets to display for this crispr