ID: 1138884908

View in Genome Browser
Species Human (GRCh38)
Location 16:61064875-61064897
Sequence CTTTATCCAGTCCATCATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 2, 1: 10, 2: 81, 3: 198, 4: 294}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138884908_1138884910 2 Left 1138884908 16:61064875-61064897 CCATAATGATGGACTGGATAAAG 0: 2
1: 10
2: 81
3: 198
4: 294
Right 1138884910 16:61064900-61064922 AATGTGGCTCATATACATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138884908 Original CRISPR CTTTATCCAGTCCATCATTA TGG (reversed) Intergenic
902484053 1:16730544-16730566 CTTAATCCAGTCTATCATTGTGG + Intergenic
907711583 1:56887741-56887763 CTTTATCCAGTCTATTATTGAGG - Intronic
907990339 1:59576157-59576179 CCTTATCCAGTCTATCATTGAGG - Intronic
908491896 1:64653001-64653023 CTTTATCCAGTCTACCACTGAGG - Intronic
908586760 1:65578190-65578212 CCTTATCCAGTCCATCACTGAGG + Intronic
909026976 1:70493571-70493593 CTTTATTCACACCTTCATTATGG - Intergenic
909836795 1:80265371-80265393 CTTTATCCAGTCCACCAGTGAGG - Intergenic
910695224 1:90006086-90006108 CATCATTCAGTCCATCATTAAGG - Intronic
911037319 1:93564767-93564789 CTTTATCCAGTGAATTATTTTGG + Intronic
911260615 1:95680880-95680902 CTTTATCCAATCCACGTTTATGG + Intergenic
911781807 1:101889260-101889282 CTTAATCCAGTCTGTCATTGAGG - Intronic
912574845 1:110659693-110659715 CTTAATCCAGTCTATCATTGGGG - Intergenic
915788470 1:158641918-158641940 CTTAATCCAGTCTACCATTGTGG - Intronic
916865993 1:168859515-168859537 CTTAATCCAGTCTATCATTATGG - Intergenic
917324460 1:173817762-173817784 CTTAATCCAGTCTATCATTGTGG - Intronic
917331106 1:173881337-173881359 CTTAATCCAGTCTATCATTGTGG + Intronic
917715024 1:177726295-177726317 CTTTATACAGCCTATCATTTAGG - Intergenic
918777315 1:188650495-188650517 CTTTATCCAGTCTGTCATTATGG - Intergenic
918959755 1:191258737-191258759 CTTAATCCAGTCTATCATTGTGG - Intergenic
919031491 1:192249053-192249075 CTTAATCCAGTCCATCATTGAGG - Intergenic
919384801 1:196907913-196907935 CTTTATCTAGTCTGTCATTTGGG - Intronic
919513671 1:198495168-198495190 CTTTTACCAGTACATCTTTATGG - Intergenic
920429198 1:205905217-205905239 CTTTATCCACTATATTATTATGG - Intergenic
921415995 1:214887449-214887471 CTTTATCCAGTCTATCACTATGG + Intergenic
921494411 1:215820973-215820995 CTTTATCCATTCATTCATGATGG + Intronic
921652017 1:217690872-217690894 CTTAATCCAGTCTATCATTGTGG + Intronic
921986025 1:221313267-221313289 CTTTGTCCAGTCTACCATGATGG + Intergenic
922377945 1:224988284-224988306 CTTTATCCAGTCTATCATTAAGG + Intronic
923232710 1:232002985-232003007 CTTTACCCAGTTCTTCATAATGG - Intronic
1063184110 10:3634887-3634909 CTTCATCCAGTCTATCATTGAGG + Intergenic
1064466037 10:15583121-15583143 CTTTATCCAGTCTATCTGGATGG - Intronic
1065140688 10:22715269-22715291 CTTCTTCCAATCCATCACTATGG + Intergenic
1065691828 10:28341916-28341938 TCTTATCCAGTCTATCATTGAGG + Intergenic
1066159035 10:32709079-32709101 CTTAATCCAGTCTATCACTGAGG - Intronic
1066597473 10:37067128-37067150 CTTAATCCAGTCTATCATTGTGG - Intergenic
1067206969 10:44226350-44226372 CTTTATCCAGTCAATCAAATGGG + Intergenic
1067760773 10:49044725-49044747 CTTTATCCATTCCTTCATGTTGG + Intronic
1068077771 10:52278566-52278588 CTTTATCCTGTCTGTCATTGTGG - Intronic
1068168619 10:53363252-53363274 ATTTAACCAGTCCATCAGAATGG - Intergenic
1068535342 10:58235424-58235446 CTTAATCCAGTCTATCATTGAGG - Intronic
1068568239 10:58599258-58599280 CTTTATCCAGTCTATTATTGAGG - Intronic
1068785826 10:60972294-60972316 CTTTATCCAGTCTATCATGATGG - Intronic
1068807455 10:61214430-61214452 ATTTATCCAGTCCCTTATTGAGG + Intergenic
1069098004 10:64283673-64283695 CTTTATCCAATCATTCATGATGG - Intergenic
1069583463 10:69580685-69580707 CTTTATCTAGTCCACCGTTGAGG + Intergenic
1071005134 10:80875403-80875425 CTTTATCCAGTCTATCATTGAGG + Intergenic
1071179013 10:82961272-82961294 ATTTTTCCAATCCATCAATATGG - Intronic
1071410845 10:85393328-85393350 CTTAATCCAGTCTATCATTGTGG + Intergenic
1071964485 10:90838324-90838346 CTACATCCAGTCCATCAGCAAGG + Intronic
1072151117 10:92684964-92684986 CTTTCTCCAGATCATCAATAAGG - Intergenic
1074023582 10:109610563-109610585 CTTAATCCAGTCTATCATTGTGG - Intergenic
1074646229 10:115456242-115456264 CTTTGTCCAGTCTAACATAATGG - Intronic
1075269970 10:121040604-121040626 TCTTATCCATTCCTTCATTAAGG + Intergenic
1076448170 10:130532969-130532991 CTTAATCCAGTCTATCACTGAGG + Intergenic
1076942877 10:133621543-133621565 CTTGATCCAGTCAGTTATTATGG - Intergenic
1077987977 11:7374304-7374326 CTTTATTCAGTCTATCATTATGG + Intronic
1078180962 11:9009776-9009798 CTTTATCCAGTCTATCATTGTGG + Intergenic
1078404764 11:11060735-11060757 CTTTATCCAGTCTATCTTGATGG - Intergenic
1078668272 11:13343620-13343642 CTTTGTCAAGTCCATCACTGAGG - Intronic
1078968784 11:16380525-16380547 GTTTAACAAGTCCATAATTATGG + Intronic
1079060326 11:17243101-17243123 CTTAATCCAGTCTATCATTGTGG - Intronic
1080182393 11:29441083-29441105 CTTTATCCAGTCCACTGTTGAGG + Intergenic
1081060692 11:38472090-38472112 CTTTATCCAGTCTATCATTTGGG - Intergenic
1081920916 11:46775579-46775601 CTTTATCCAGTCTAACATGATGG - Intronic
1081945548 11:46990030-46990052 CTTTATCCAGTTCACCTTGATGG + Intronic
1082292215 11:50389623-50389645 CTTAATCCAGTCTACCATTGTGG - Intergenic
1082578984 11:54843605-54843627 CTTAATCCAGTCTACCATTGTGG - Intergenic
1082634777 11:55582937-55582959 CCTAATCCAGTCTATCATTGTGG - Intergenic
1083056430 11:59825268-59825290 CTTTATCCAATCTACCATCATGG + Intergenic
1083141684 11:60727144-60727166 CTTTATCCAGTCTATTGTTGAGG + Intergenic
1086589792 11:88499952-88499974 CTTTATCCAGTCGATGACTTTGG + Intergenic
1086607936 11:88719446-88719468 CTTCATCCAGTCTATCATGATGG + Intronic
1087350903 11:97030598-97030620 CCTTATCCAGTCTGTCATTGAGG + Intergenic
1087417796 11:97880115-97880137 CTTTATCCAGTCTATCATTGTGG + Intergenic
1089252851 11:117177930-117177952 ATTTAACCAATCCCTCATTATGG + Intergenic
1089664404 11:120009003-120009025 CTGTCTCCATTCCATCACTATGG + Intergenic
1090057609 11:123437136-123437158 CTTAATCCAGTCTATCAAGATGG + Intergenic
1090096649 11:123748603-123748625 CTTTATCCAGTCCACCATTGAGG + Intergenic
1091163417 11:133447754-133447776 ATTTATCCAGTCCACCACTGAGG + Intronic
1091970283 12:4780853-4780875 CTGTCTCCACTCCATCCTTAGGG + Intronic
1092102210 12:5893873-5893895 CTTTATCCAGTCTACCTTTATGG + Intronic
1092907234 12:13112590-13112612 CTTGATCCATTCCAGTATTACGG + Intronic
1093516652 12:19994880-19994902 AATTATTCAGTCCATGATTAAGG - Intergenic
1093674569 12:21922181-21922203 ATTTTTCCAGTCCATGAATATGG + Intronic
1093787865 12:23213544-23213566 CTTTATCCAGTCTACCATTGAGG + Intergenic
1095346181 12:41151167-41151189 CTTTATTCACTCCCTCATTTTGG + Intergenic
1095429438 12:42116886-42116908 CTTAATCCAGTCTATCATTGTGG - Intronic
1095445559 12:42278792-42278814 CTTTATCCAGTCTATCATTATGG - Intronic
1095575073 12:43727441-43727463 CTTTATCCAGTCCACTGTAATGG - Intergenic
1096049127 12:48591513-48591535 CTTTATCCAGTCTATCATTGTGG - Intergenic
1097653885 12:62337864-62337886 CTTTATCCAGTCTATCAGGATGG + Intronic
1098198888 12:68034024-68034046 TTTTATCCAGTTAATTATTAGGG - Intergenic
1098222221 12:68282375-68282397 TATTATCCAGTCCTTCTTTAGGG + Intronic
1098241170 12:68468524-68468546 CTTCCTCCAGTCCCTCATTGTGG + Intergenic
1098924617 12:76335659-76335681 TTTTCTTCAGTTCATCATTATGG + Intergenic
1099011111 12:77292293-77292315 CTTTATCCAGTCTAACATTTAGG - Intergenic
1099050096 12:77771522-77771544 CTTAATCTAGTCTATCATTGTGG - Intergenic
1099409759 12:82310872-82310894 CTTAATCCAGTCTATCATTGAGG + Intronic
1099617146 12:84950560-84950582 CTTTATCAAGTTCACCATTATGG - Intergenic
1099892778 12:88610164-88610186 CTTTATGCAGTCTATCATTATGG - Intergenic
1101070749 12:101073180-101073202 CTTAATCCAGTCTATCATTTGGG - Intronic
1101829317 12:108244976-108244998 CTTTATCCAGTCCTCCACTGAGG + Intronic
1101887200 12:108675720-108675742 CTATATCCAGTCATTCACTAGGG - Intronic
1103863361 12:124031727-124031749 CTTTATCCAGTCTATCTTTGAGG + Intronic
1105322627 13:19343653-19343675 CTTAATCCAGTCTATCATTATGG - Intergenic
1105567011 13:21559299-21559321 ATTTATCCAGTCTGTTATTAAGG + Intronic
1106018647 13:25893433-25893455 CTTAATCCAGTCTATCATTGTGG + Intronic
1106219295 13:27732118-27732140 CTTAATCCAGTCTATCACTGAGG + Intergenic
1106573119 13:30948122-30948144 CTTAATCCAGTCTATCATTGTGG + Intronic
1108187286 13:47900955-47900977 CTTTATCCAGTCTATTATTGTGG - Intergenic
1108734391 13:53267445-53267467 CTTTATCCAGTCTATCATTGAGG + Intergenic
1108967110 13:56322108-56322130 CTTTATCTAGTCTAACATTGAGG + Intergenic
1109601300 13:64633273-64633295 CTTAATCCAGTCTATCATTGTGG - Intergenic
1109804352 13:67418551-67418573 CTTCATCCAGTCTATCATTATGG + Intergenic
1109884872 13:68528890-68528912 CTTTATCCAGTCTAACAATGAGG - Intergenic
1110020486 13:70463160-70463182 CTTTATCCAGTCTATCATGATGG - Intergenic
1110208415 13:72945277-72945299 CTTTATCCAATCCATTGTTATGG + Intronic
1110362901 13:74647792-74647814 CATTATTAAGTCCGTCATTAAGG - Intergenic
1110385296 13:74903898-74903920 CTTGGTCCAGTCCATCTTCAAGG - Intergenic
1110890796 13:80695345-80695367 CTTTATCCAGTCTATATTGATGG - Intergenic
1111142805 13:84143405-84143427 CTTTATCCAGTCTATCACTGTGG + Intergenic
1111229661 13:85327758-85327780 CTTTAACCATTCATTCATTATGG + Intergenic
1111260829 13:85737891-85737913 CTTTATCCAGTCCAGTGTTGGGG - Intergenic
1111332378 13:86776421-86776443 CTTTATCCAGTCTATCACTGAGG + Intergenic
1111369027 13:87291663-87291685 TTTTATCCAGTCCACCATTGTGG + Intergenic
1111494142 13:89025931-89025953 CTTTATCCAGTCTATCATTGAGG - Intergenic
1111972421 13:94930648-94930670 CTTTATCCAGTCTATGTTGATGG + Intergenic
1112796174 13:103058781-103058803 CTTGATCTAGTCCATTTTTATGG + Intronic
1113025260 13:105933755-105933777 CTTGGTCCAGTCCATCCATAAGG + Intergenic
1113066520 13:106378502-106378524 CTGTACCCAGTTAATCATTAGGG + Intergenic
1113143699 13:107183601-107183623 CTTTATCCAGCCTATCACTGAGG - Intronic
1113225862 13:108158958-108158980 ATTTAACCAGTCCTTCCTTAGGG - Intergenic
1113281550 13:108793936-108793958 CTTTATCCCGTCCACCTTGACGG - Intronic
1114760243 14:25306317-25306339 CTTTATCCAATCTATTGTTATGG - Intergenic
1114944693 14:27664974-27664996 CTTTATCCAGTCAATCATTGAGG + Intergenic
1115938746 14:38585033-38585055 CTTTGTCCAGCCTATCATTGAGG + Intergenic
1115945780 14:38658774-38658796 CTTTAACCAGGTCACCATTAAGG - Intergenic
1116141639 14:41002965-41002987 CTTTAATCAATCAATCATTATGG - Intergenic
1116384566 14:44314664-44314686 CTTAATCCAGTCTATTATTGTGG - Intergenic
1116544869 14:46152382-46152404 CTTAATCCAGTCTATCATTGCGG + Intergenic
1116672318 14:47859155-47859177 CTTTATCCAATCCACCATTGAGG + Intergenic
1118074675 14:62284879-62284901 CTTAATCCAGTCTATCATTGTGG + Intergenic
1118899340 14:69973448-69973470 TTTTTTCCATTCCACCATTAAGG + Intronic
1120070450 14:80096847-80096869 CTTTATCCAGTCTATCATTGAGG - Intergenic
1120861299 14:89257178-89257200 CTATTTCCATTCCATCATGAGGG + Intronic
1121003320 14:90468072-90468094 CTTTATCCAGTCTATCATGATGG + Intergenic
1121600859 14:95201962-95201984 CTTTATCCAGTCTATCACTGGGG + Intronic
1122357843 14:101134666-101134688 TTTTATCCATTCCATCCTTTTGG - Intergenic
1122403188 14:101479572-101479594 CTTTATCCAGTCCACCACTGAGG - Intergenic
1123796176 15:23773086-23773108 CTTTATCCAGTCCACCTAGATGG + Intergenic
1126313584 15:47343639-47343661 CTTAATCCAGTCTATCATTGTGG + Intronic
1126507143 15:49418418-49418440 CTTTATCCAGTCTACCATTGAGG - Intronic
1126540635 15:49818868-49818890 CTTTATCCAATCTACCATTGAGG - Intergenic
1126617185 15:50596280-50596302 CTTTGTACAGTATATCATTATGG - Exonic
1126897991 15:53280473-53280495 CTTTATCCAGTCTATCATCGTGG - Intergenic
1128954002 15:71920164-71920186 CTTTCTTAATTCCATCATTATGG + Intronic
1129498610 15:76013725-76013747 CTTTATCCAGTCTATCATTGAGG + Intronic
1129587856 15:76886758-76886780 CTTTATCCAGTCAATCATTGAGG - Intronic
1129623680 15:77174210-77174232 CTTTATAGAGCCCTTCATTATGG - Intronic
1131389986 15:92039822-92039844 CTTTATCCAGTCTATCATGATGG - Intronic
1131722931 15:95190252-95190274 CTTTATCCAGTTCACCATTTTGG - Intergenic
1132255204 15:100370894-100370916 CTTAATCCAGTCTATCATTGTGG - Intergenic
1133499846 16:6355517-6355539 CTTCATCCAGTCTATTATTGAGG + Intronic
1134297106 16:12956482-12956504 CTTTATCCAATCAACCATTAAGG - Intronic
1134356329 16:13485424-13485446 CTTTATCCAGTCTATCATTGAGG + Intergenic
1134376167 16:13676273-13676295 CTTTATCCAGTCTATCATTGAGG + Intergenic
1134505033 16:14798262-14798284 CTGTATCCAGTCCATTTGTAAGG - Intronic
1134575541 16:15330647-15330669 CTGTATCCAGTCCATTTGTAAGG + Intergenic
1134726904 16:16425853-16425875 CTGTATCCAGTCCATTTGTAAGG - Intergenic
1134796582 16:17042962-17042984 CTTTATCCAGTCTATATTGATGG - Intergenic
1134796642 16:17043881-17043903 CTTTATCCAGTCTATATTGATGG + Intergenic
1134940533 16:18286010-18286032 CTGTATCCAGTCCATTTGTAAGG + Intergenic
1137040602 16:35608859-35608881 CTTAATCCAGTCTATCATTGTGG + Intergenic
1138124164 16:54425150-54425172 CTATCTCCATTCCATCTTTAGGG - Intergenic
1138483434 16:57319195-57319217 CTTTATCCAGTCTATCAACTGGG - Intergenic
1138884908 16:61064875-61064897 CTTTATCCAGTCCATCATTATGG - Intergenic
1138980551 16:62262832-62262854 CTTTATCCAGTTTATTATTGAGG - Intergenic
1139094961 16:63694373-63694395 CTTTATACAATCCACCATTGTGG - Intergenic
1139229457 16:65269452-65269474 CTTTATCCAATCGACCATTGTGG + Intergenic
1140575109 16:76158525-76158547 CTTAATCCTGTCCATCATTTTGG + Intergenic
1140637760 16:76936306-76936328 CTAGATCCACTCCATCATTGTGG - Intergenic
1140795393 16:78432863-78432885 CATTGTCCAGCCCATCATAAAGG + Intronic
1141274424 16:82573678-82573700 CTTTATCCTGTCCATAGTTGAGG + Intergenic
1142299108 16:89246434-89246456 CTTTATCCAGTCTATCATGATGG - Intergenic
1142495988 17:306582-306604 CTTAATTCAGGCCTTCATTATGG + Intronic
1143621364 17:8082122-8082144 CTTTATCCAGTCATCCATTAGGG + Intronic
1144020635 17:11238261-11238283 ATTTCTCCTATCCATCATTAAGG + Intergenic
1145713962 17:27002032-27002054 CTTTCTCCAGCCCAGCAATAAGG + Intergenic
1146085791 17:29828073-29828095 CTTTATCTAGTCTAACATGATGG - Intronic
1146819931 17:35976840-35976862 ATTTTTCCTGTCCATCTTTATGG - Exonic
1146923825 17:36730727-36730749 CTTTATCCAGTGCATCAATGGGG + Intergenic
1149021232 17:51967446-51967468 CTTTATCCAGTCCACCATTGAGG - Intronic
1149989711 17:61376056-61376078 CTTTATCCAGTCCAGCCCTAGGG + Intronic
1150853534 17:68728841-68728863 CTTTATCCAGTCTATATTGATGG - Intergenic
1150871871 17:68920958-68920980 CTTAATCCAGTCTATCATTGAGG - Intronic
1150928544 17:69559658-69559680 CTTAATCCAGTCTATCATTGAGG + Intergenic
1151077354 17:71288740-71288762 CTTAATCCAGTTTATCATTGTGG + Intergenic
1151150433 17:72081008-72081030 CTTTATCCAGTCTACCATTGTGG - Intergenic
1153035669 18:760092-760114 CTTAATCCAGTCTATCACTGAGG + Intronic
1153066127 18:1046963-1046985 CTTTATACAGTCTATCTTGATGG + Intergenic
1153359271 18:4174992-4175014 CTTTATCCAGTCTATCACAATGG + Intronic
1155494738 18:26431681-26431703 CTTTCTCCAGTCCAACATCCTGG + Intergenic
1155587975 18:27389760-27389782 CTTTATCCAGTCCATGTTGATGG + Intergenic
1155725830 18:29081981-29082003 TTCTATCCTGTCCATAATTAAGG + Intergenic
1156168490 18:34453334-34453356 CTTTATCCAGTCTACCATTATGG - Intergenic
1156692562 18:39726007-39726029 CTATATCCATCCCATCAATAGGG + Intergenic
1158671056 18:59474121-59474143 CTTTATCCAATCCACTACTATGG + Intronic
1159026864 18:63191085-63191107 CTTTATCCAGTCTATCATTGAGG + Intronic
1159416927 18:68164271-68164293 CTTTACCCAGTCTATCATTCAGG - Intergenic
1163099674 19:15087197-15087219 CATTATCCTGGCCATCATCACGG + Exonic
1164364599 19:27562827-27562849 CTTAATCCAGTCTATCATTGTGG - Intergenic
1164917408 19:32062974-32062996 CTTTATTCAGTCTCTCATTGTGG - Intergenic
1164977864 19:32587896-32587918 CTTAATCCAGTCTATCATTGTGG + Intergenic
1165292802 19:34902797-34902819 CTTTTTCCAGTCCACTATCATGG - Intergenic
1165965703 19:39577804-39577826 CTTTATCCAGTCTATCATTTGGG + Intergenic
1165987858 19:39786401-39786423 GTTTATTCAGTCCATCAATCAGG - Intergenic
1166176215 19:41073095-41073117 CTTTATCCAGTCTACCATTTTGG - Intergenic
1166612992 19:44216166-44216188 CTTTTTGCAGTCCATCTTTTAGG + Intronic
1167930680 19:52861382-52861404 ATTTTTCCAATCCATCAATATGG - Intergenic
1168006468 19:53493326-53493348 ATTTTTCCAATCCATCAATATGG + Exonic
1202708126 1_KI270713v1_random:39283-39305 CTTAATCCAGTCTATCATTGTGG - Intergenic
925252237 2:2449471-2449493 CTTTATCCAGTCTGTCATTGAGG + Intergenic
925431144 2:3794748-3794770 CTTAATCCAGTCTATCACTTTGG + Intronic
925462857 2:4079330-4079352 CTTAATCCAGTCTATCATTGAGG + Intergenic
925493138 2:4418192-4418214 CTTTATCCAGTCTACCACTGAGG - Intergenic
925518209 2:4708703-4708725 CTTAATCCAGTCTATCATTGTGG - Intergenic
925608157 2:5680072-5680094 CTTTATCCAGTCTATCACTGAGG + Intergenic
925825322 2:7842696-7842718 CTTTATCCAGTCTATCATTGTGG - Intergenic
925884788 2:8385418-8385440 CTTTATCCAGTTTATCACTGAGG + Intergenic
926876735 2:17488857-17488879 CTTTATCCAGTCTATCTTGATGG + Intergenic
928426127 2:31179453-31179475 CTGAATCCAGTCTATCATTGAGG + Intronic
929361323 2:41094765-41094787 CTTTATCCAGTCTATTATTGAGG - Intergenic
929373161 2:41251293-41251315 TTTTATCCATTCCACCATGATGG + Intergenic
929412173 2:41709088-41709110 CTTTATCCAGTCTATATTCATGG + Intergenic
930793157 2:55356382-55356404 CTTTATCCAATCTATCATTGAGG + Intronic
930961231 2:57264374-57264396 CTTTATCCAGTCTATCATTGAGG - Intergenic
931532963 2:63237580-63237602 CATTATCCAGTTCACCATTATGG - Intronic
932979394 2:76646017-76646039 CTTTATGCAATCTATCATTGAGG - Intergenic
933318296 2:80741263-80741285 CTTTATCCAGTCTATATTGATGG - Intergenic
933388378 2:81639915-81639937 CTTTATCCAGTCTATCATTTAGG - Intergenic
933413502 2:81954488-81954510 CTTTATCCAGTCTACCATTTGGG - Intergenic
933444030 2:82354228-82354250 CTTTATCCAGTCTGTCACTGAGG + Intergenic
933504784 2:83163044-83163066 CTTTATCCTGTTAATCATAAAGG - Intergenic
933547875 2:83738293-83738315 CTTTATCCAGTCTATTATTGAGG + Intergenic
933623186 2:84568327-84568349 CTTTATCCAGTCTATCACTATGG - Intronic
936880154 2:117240957-117240979 CTTAATCCAGTCTATCATTTTGG - Intergenic
937240174 2:120455468-120455490 CATTATCCAATCCAACATCACGG - Intergenic
937744122 2:125390306-125390328 CTTAATCCAGTCTATCATTGAGG + Intergenic
938810812 2:134851194-134851216 CTTTATCCAGTTCATCGTTATGG + Intronic
939207589 2:139127611-139127633 CTTTCTCCATTCCAGCAATAAGG - Intergenic
940199656 2:151136526-151136548 TTTAATTCAGTCCATCATGAGGG - Intergenic
940628693 2:156209832-156209854 CTTTATCCAGTCTACTATTGAGG + Intergenic
940720107 2:157272761-157272783 CTTTATCCAATCCACCATTGAGG + Intronic
942774446 2:179564486-179564508 CTTTAGTCAGTCCATTCTTAAGG + Intronic
942780382 2:179634811-179634833 CTTAATCCAGTCTATCATTGAGG - Intronic
943012944 2:182473872-182473894 CTTTATCCTGTCTATCACGATGG + Intronic
943096150 2:183431748-183431770 CTTTATCCAGTCTATCGTGATGG - Intergenic
943762935 2:191629547-191629569 CTTTATCCATTCCTCCATCAAGG + Intergenic
943866042 2:192925550-192925572 CTTAATCCATTCTATCATTGAGG + Intergenic
943866765 2:192934391-192934413 CTTTGTCCAGTCCAACATCCTGG + Intergenic
943998685 2:194804779-194804801 CTTAATCCAGTCTATCATTGTGG + Intergenic
943999270 2:194811635-194811657 CTTAATCCAGTCTATCATTGTGG - Intergenic
944042635 2:195373599-195373621 CTTAATCCAATCTATCATTGTGG + Intergenic
944374657 2:199028049-199028071 CTTAATCCAGTCTATCATTGTGG - Intergenic
944779007 2:202998460-202998482 CTTTATCCAGTCCACCGTGATGG + Intronic
945058772 2:205890470-205890492 CTTTATCCAGTCCACGTTGATGG - Intergenic
945160948 2:206889914-206889936 CTTTATCCAGTTTACCATAATGG + Intergenic
945969678 2:216223382-216223404 CTTAACCCAGTCAATAATTATGG - Intergenic
946067762 2:217003901-217003923 CTTAATCCAGTCTATCATTGTGG + Intergenic
946454574 2:219813890-219813912 CTTAATCCAGTCTATCATTGTGG + Intergenic
947198120 2:227589269-227589291 CTTTATCCAGTCTACTATTATGG - Intergenic
947898760 2:233701102-233701124 CTTAATCCAGTCTATCATTGAGG + Intronic
948552262 2:238781396-238781418 CTTTATCCAGTCTACCATTGTGG - Intergenic
948557069 2:238820317-238820339 CTTTATCCAGTCCACTGTGATGG - Intergenic
1169311294 20:4542554-4542576 TTTTATTCAATCCATCATAAAGG - Intergenic
1169509060 20:6244349-6244371 CTTTATCCAGTATATCATTGAGG + Intergenic
1173461480 20:43246717-43246739 CTTTATCCTGTGCATGATTGGGG - Intergenic
1175014708 20:55777012-55777034 CTTTATCCAGTCTATCCTGATGG + Intergenic
1175557997 20:59887380-59887402 CTTAATCCAGTCTATCATTGAGG + Intronic
1176523110 21:7839788-7839810 CTTTATCCAGTCTAGCATTTAGG - Intergenic
1176961906 21:15168533-15168555 CTTTATCCAGTCTATCACTATGG - Intergenic
1178080692 21:29061281-29061303 CTTTATGCAGTACATCAAGAAGG - Exonic
1178118751 21:29446103-29446125 TTTTATCCAATCAATCATTACGG - Intronic
1178657130 21:34469800-34469822 CTTTATCCAGTCTAGCATTTAGG - Intergenic
1178772268 21:35516741-35516763 CTTAATCCAGTCTATCGTTTTGG - Intronic
1178968122 21:37143851-37143873 CTTAATCCAGTCTATCACTGAGG - Intronic
1178987176 21:37316222-37316244 CTTAATCCAGTCTATCACTGAGG - Intergenic
1179023802 21:37662494-37662516 CTTTATCCAGTCTATCATTGTGG + Intronic
1180596761 22:16980765-16980787 CTTTATCCAGTCTATCATTGAGG - Intronic
1181883315 22:25998965-25998987 CTTTGTCTATTCCAGCATTACGG + Intronic
1181912400 22:26249564-26249586 CTTTATCCATTCATCCATTATGG + Intronic
1182970478 22:34569788-34569810 CTTTGTACAGTCCATACTTAAGG + Intergenic
1183574000 22:38675419-38675441 CTGTCTGCAGTCCATCCTTACGG + Intergenic
949583917 3:5418501-5418523 CTTTATCCAGTCTATCATTATGG - Intergenic
950309767 3:11946871-11946893 CTTAATCCAGTCTATCATTGTGG + Intergenic
950596274 3:13985521-13985543 CTTTATCCAGTCTATCTTTGAGG + Intronic
951189877 3:19755644-19755666 CTTAATCCAGTCTATCATTGAGG + Intergenic
951194371 3:19807319-19807341 CTTTATCCAGTCTACCACTGAGG - Intergenic
951461225 3:22953793-22953815 CTTAATCCAGTCTATCATGTTGG + Intergenic
951570076 3:24053177-24053199 CTTAATCCAGTCTATCATGATGG + Intergenic
951577824 3:24131689-24131711 CCTTGTCCTGTCCATCATGAAGG + Intronic
951837058 3:26995245-26995267 CTTAATCCAGTCTATCATTTGGG - Intergenic
951928287 3:27934697-27934719 CTCTATGCAGTCCACCATTAAGG - Intergenic
953308217 3:41850194-41850216 CTTAATCCAGTCTATCATTGTGG + Intronic
954066772 3:48112992-48113014 TTTTATCCAGTCCATCAGGCTGG - Intergenic
954477502 3:50761864-50761886 CTTAATCCAGTCTATCATTGTGG - Intronic
955445843 3:59008467-59008489 CTTAATCCAGTCTATCGTTCAGG - Intronic
955510449 3:59675428-59675450 CTTTATCCAGTCAATCCTTATGG - Intergenic
956035192 3:65083138-65083160 CTTTGTCCAGAGCATCCTTAGGG + Intergenic
956147162 3:66202120-66202142 CTTTATCCAGTCTATCACTGAGG - Intronic
956155659 3:66293772-66293794 CTTTATCCAGTGTTTTATTACGG + Intronic
956354506 3:68376639-68376661 GTTTATCCAGTCTACCATGAGGG + Intronic
957003773 3:74918879-74918901 CTTTATCCAGTCTATTATTATGG + Intergenic
957578892 3:82045125-82045147 CTTTAGCCAGTCTTTCTTTATGG + Intergenic
958087426 3:88828437-88828459 CTTTATCCAATTCACCATGATGG + Intergenic
958427059 3:93990931-93990953 CTTTATCCAGCCCAAAGTTAGGG - Intronic
958626503 3:96631723-96631745 ATTTATCTAGCCCATCATCATGG + Intergenic
958783364 3:98569539-98569561 CTTTATCCATTCTATCATTGAGG + Intronic
959165258 3:102768904-102768926 CTTTATCCAGTCTATCATTGAGG + Intergenic
959316502 3:104814538-104814560 CTTTATCCAGTCCATTGCTGAGG - Intergenic
960278703 3:115756627-115756649 CTTTATCCAGTCTATCATTTGGG - Intergenic
960560392 3:119077026-119077048 CTTAATCCAGTCTATCATTGTGG - Intronic
961398825 3:126619315-126619337 CTTTATCCATTCATGCATTATGG - Intronic
961671370 3:128533994-128534016 CTGTATCCAATCAATCAGTAGGG - Intergenic
961716681 3:128862346-128862368 CTTAATCCAGTCTATCTTGATGG - Intergenic
961926442 3:130486631-130486653 CTTAATCCAGTCTATCATTGTGG + Intergenic
962175060 3:133144355-133144377 CTTTATCCAGTCTATCATTGAGG + Intronic
964753702 3:160075867-160075889 CTTTTTCAAGTCCATCTTTGTGG + Intergenic
964822458 3:160786987-160787009 CTTTATTCTATCCATCATTGAGG + Intronic
964874304 3:161348396-161348418 CTTTCTCAAGGCCATCATTAAGG - Intronic
965963520 3:174457457-174457479 CTTTATCCAGTCCACCACTAAGG - Intronic
966070422 3:175870723-175870745 CTTTATGCAGTCTATCATTGAGG + Intergenic
966346242 3:178983757-178983779 CTTTATCCAGTCTATCATTGAGG + Intergenic
966368196 3:179214100-179214122 CTTTCTCCATTTCAGCATTAAGG + Intronic
966453563 3:180090072-180090094 CTTTATCTAGTCTACCATGATGG + Intergenic
967507634 3:190270994-190271016 CTTTATCCAGTCTATCATTAAGG + Intergenic
969863339 4:10055043-10055065 CTTTTTCCAGTTCATCAAAAAGG + Intergenic
970169011 4:13270215-13270237 CTTTATCCAATCCACCATTTTGG + Intergenic
970178520 4:13363478-13363500 CTGAATCCAGTCCATCCATAGGG + Intronic
970739029 4:19211147-19211169 CTTTATACTTTCCATCATTTGGG + Intergenic
970948259 4:21720901-21720923 CTGAATCCAGTCTATCATGATGG + Intronic
971575729 4:28271852-28271874 TTTTATCCAGTCTAACATTAAGG - Intergenic
972065186 4:34933891-34933913 CTTTATCTAGTCTATCATTGAGG + Intergenic
972983768 4:44738889-44738911 CTTTTTCTAGTCCATCTTTATGG + Intergenic
972994666 4:44865074-44865096 CTTTATCCAGTCCACTTTGATGG + Intergenic
973086922 4:46075593-46075615 CTTTTTCCTGTCTATCATTTGGG + Intronic
973541005 4:51935458-51935480 CTTAATCCAGTCTATCATTGTGG + Intergenic
974360853 4:60877246-60877268 CTTTATCCAGTCTATCACTGAGG - Intergenic
974366279 4:60953776-60953798 CTTTATCCAGTCCACCAATGTGG + Intergenic
974378200 4:61104546-61104568 CTTAATCCAGTCTATCATTGTGG + Intergenic
974666212 4:64965093-64965115 CTTTATCCAGTCTATCGTGATGG + Intergenic
974739497 4:65987212-65987234 CTTTATCCAGTCTATCATTGAGG - Intergenic
974795326 4:66741799-66741821 ATTTATCCAGTCTACCATTGAGG + Intergenic
975147013 4:70979541-70979563 CATTATCCAGTCCCTCCATATGG - Intronic
975888911 4:79000724-79000746 CTTAATCCAGTCTATCATTGTGG + Intergenic
976378321 4:84370513-84370535 CTTTATCCAGTCCACCACTGAGG + Intergenic
976716526 4:88128529-88128551 CTTTATTCAGTCTATCATTATGG - Intronic
977502242 4:97855135-97855157 CTTTATCTAGTCTATCATTGAGG + Intronic
977757155 4:100685720-100685742 CTATATCCAGTCCATGGTGATGG - Intronic
977922499 4:102660907-102660929 CTTTATCTGGTCCATGTTTATGG - Intronic
977967484 4:103169891-103169913 CTTTATCCAGTCTATCATTGAGG - Intronic
977994957 4:103490496-103490518 CTTTATCCAGTCTATCACTGAGG - Intergenic
978090817 4:104712557-104712579 CTATATTCAGTCTATCATTGAGG - Intergenic
978305311 4:107322062-107322084 CTTTATCCAGTCTGTCATTGGGG + Intergenic
978474307 4:109108695-109108717 CTTTCTCCAATCCTTCATTAAGG + Intronic
978893586 4:113857893-113857915 CTTAATCCAGTCTATCCTTGTGG - Intergenic
979597486 4:122550361-122550383 CTTTATCCAGTCCACCACTGAGG - Intergenic
979634317 4:122940014-122940036 CTTAATCCAGTCTGTCATTGTGG + Intronic
979906039 4:126294815-126294837 CTTTCTCCAGTCTATTGTTAAGG + Intergenic
979976304 4:127200478-127200500 CTTTATCCAGTCAACCTTTGAGG - Intergenic
979978691 4:127227730-127227752 CTTAATCTAGTCTATCATTGTGG - Intergenic
980037305 4:127899934-127899956 CTTAATCCAGTCTATCATTAAGG + Intergenic
980089878 4:128431889-128431911 CTTAATCTAGTCTATCATTTTGG + Intergenic
981388206 4:144156388-144156410 CTTTATCTAATCTATCATGATGG + Intergenic
981402346 4:144328194-144328216 CTTTATCCAGTCAATGGTTGAGG - Intergenic
981448189 4:144865139-144865161 CTTTATCCAGTCTAACATGATGG + Intergenic
982813259 4:159853758-159853780 CTTTATCCACTCTATCATTGAGG - Intergenic
982859329 4:160429117-160429139 CTTTATCCAGTCTATTGTGATGG + Intergenic
983129788 4:164003894-164003916 CTTCATCCAGTCTATCATTGTGG - Intronic
983315624 4:166129299-166129321 CTTTATCCAGTCTATCATTGAGG + Intergenic
983348451 4:166557323-166557345 CTTTGTCCAGACCAGCATTCTGG + Intergenic
983602081 4:169542385-169542407 CTTTATCCAGTCTATCCTGATGG + Intronic
985218362 4:187676507-187676529 CTTAATCCAGTCTATCATTGTGG + Intergenic
985390597 4:189488588-189488610 CTTAATCCAGTCTATCATTGTGG - Intergenic
986548835 5:8929843-8929865 CTTTATCCAGTCTATCATTGAGG + Intergenic
986659675 5:10047779-10047801 CATTATCCAGCTCATCATTCAGG - Intergenic
986792393 5:11174656-11174678 CGTTAGCCAGTTGATCATTATGG + Intronic
987175724 5:15306409-15306431 CTTTATCCAATCTGTCATTGAGG + Intergenic
987615504 5:20268672-20268694 TTGTATCCAGTACATAATTATGG - Intronic
987869703 5:23599560-23599582 CTTTATCCAGTCTATCATTATGG + Intergenic
987959054 5:24780189-24780211 CTTAATCCAGTCTACCATTCAGG + Intergenic
988328125 5:29797897-29797919 CTTAATCCAGTCTATCATCGTGG + Intergenic
988654411 5:33192366-33192388 CTTAGTCCAGTCTATCATTGTGG + Intergenic
989846944 5:46156682-46156704 CTTAATCCAGTCTATCATTGAGG + Intergenic
989848133 5:46172149-46172171 CTTAATCCAGTCTATCATTGAGG - Intergenic
989941165 5:50151480-50151502 CTTAATCCAGTCTATCATTTTGG - Intergenic
990089846 5:52029492-52029514 CTTTATCCAGTCTATCATTATGG + Intronic
990194477 5:53298705-53298727 CTTTATCCAGTCTACCATTGTGG + Intergenic
990491019 5:56303067-56303089 CTTTTTCCAGACCATCCTGATGG - Intergenic
990654726 5:57942388-57942410 CTTAATCCAGTCTATCATTGGGG + Intergenic
990965647 5:61444330-61444352 CTTAATCCAGTCTATCGTTGTGG + Intronic
992740039 5:79764385-79764407 CTTTATCCAGTCTATCATTTGGG + Intronic
993034259 5:82739811-82739833 CTTTCTCTTGTCCATCATTTAGG - Intergenic
994339187 5:98605703-98605725 CTTTATCCAGGCCTTCACTTAGG + Intergenic
994970970 5:106736295-106736317 TTCTATCCAGTCTATCATTTAGG - Intergenic
995472435 5:112516868-112516890 CTTAATCCAGTCTATCATTGGGG + Intergenic
995661397 5:114487659-114487681 CTTTATCCAGACCACTATTATGG + Intronic
996327663 5:122293877-122293899 CTTTATCCAATCCACCATTGAGG + Intergenic
996586379 5:125092588-125092610 CTTTATTCAGTCTATCTTGATGG - Intergenic
996773807 5:127112879-127112901 CTTTAACCAGTCCACCATTATGG - Intergenic
996864737 5:128107674-128107696 CTTTATTCAGTCTATCATTGTGG + Intronic
997071070 5:130622784-130622806 CTTAATCCAGTCTATCATTGAGG - Intergenic
997836536 5:137198424-137198446 GTTTATCCAGCCCGTCAATATGG - Intronic
999071935 5:148752618-148752640 CTTTATCCAGTCTATCATTAAGG + Intergenic
1000414839 5:160973573-160973595 CTTTATCCAGTTTATCGTTGAGG - Intergenic
1001167803 5:169386751-169386773 CTTTATCCAGTCTATCATTGAGG - Intergenic
1003739037 6:8913781-8913803 CTTTCTCCAGTCCACCACTGGGG - Intergenic
1004717673 6:18233945-18233967 CTTAATCCAGTCTATCATTTGGG - Intronic
1005247592 6:23906158-23906180 CTTTATCCAGTATATCACTGAGG + Intergenic
1005351769 6:24943099-24943121 CTTAATCCAATCTATCATTGTGG - Intronic
1007814777 6:44513925-44513947 CCTTATCCACTCCCTCATGATGG - Intergenic
1008676406 6:53823874-53823896 CTTTATCCAGTCTACCATTGAGG + Intronic
1008752714 6:54756790-54756812 CTTTATCCAGTCTAACACTGAGG + Intergenic
1009279411 6:61728045-61728067 CTATATCCAGTCTATCATGTTGG - Intronic
1009742664 6:67767524-67767546 CTTTATCCAGTCTGTCATTGAGG - Intergenic
1010131119 6:72494653-72494675 CTATATCCAGTCCACCATGATGG - Intergenic
1010363142 6:75018063-75018085 CTTAATCCAGTCTATCATTGTGG - Intergenic
1010529898 6:76955238-76955260 CTTTTATCAGTCCATTATTATGG - Intergenic
1010593616 6:77738475-77738497 CTTTATCCAGTCTATCATTGAGG + Intronic
1012222311 6:96663882-96663904 CTTTATTCAATCCACCATGATGG - Intergenic
1012740680 6:103012912-103012934 CTTTATCCAGTCTATCATTGAGG + Intergenic
1012746066 6:103091171-103091193 CTTCATCCAGTCTACCATTGAGG - Intergenic
1012850112 6:104436669-104436691 CTTTATTCAGTCTGTCATTGAGG - Intergenic
1013333952 6:109136173-109136195 CTTAATCCAGTCTATCACTGAGG - Intronic
1013453273 6:110305933-110305955 CTTTATCCAGTCTAACATTGTGG - Intronic
1013933490 6:115564909-115564931 CTTTATCCAATCCACCATTGTGG - Intergenic
1014066344 6:117131141-117131163 CTTTATCCAGTCTATCATTTGGG - Intergenic
1014359092 6:120452996-120453018 CTTTATTCAGTCTATCATTCAGG - Intergenic
1014904138 6:127005710-127005732 CTTTATCCAGTCTATCATTGAGG + Intergenic
1015178332 6:130335772-130335794 CTTAATCCAGTCTATCATTGTGG - Intronic
1015443958 6:133282002-133282024 CTTTATCCATTCCATTGTTGTGG + Intronic
1016077150 6:139809648-139809670 CTTTATCCAGTCCATCGTTATGG - Intergenic
1016490493 6:144595669-144595691 CTTTATTCAATCCAGAATTAGGG + Intronic
1016644703 6:146392919-146392941 CTTTATCTAGTCTATCATTGTGG + Intronic
1020647587 7:10833709-10833731 CTTTATCCAATCCATACTGATGG - Intergenic
1020925501 7:14318895-14318917 CTTAATCCAGTCTATCATTGTGG - Intronic
1020949193 7:14653263-14653285 CTTAATCCAGTCTATCATTGTGG - Intronic
1020949867 7:14661813-14661835 CTTAATCCAGTCTATCATTGTGG - Intronic
1021231882 7:18094787-18094809 TTTCATCCAGTAAATCATTAAGG + Intronic
1021304363 7:19013068-19013090 CTTTATCCAATCCACCTTGATGG + Intergenic
1021401400 7:20213532-20213554 CTTTATCCAGTCCATCATTATGG - Intronic
1021626000 7:22593685-22593707 CTTTATCCAGTCTATCATTATGG + Intronic
1021638637 7:22716349-22716371 ATTTAACCAGTCCCCCATTAAGG - Intergenic
1022059084 7:26772609-26772631 CTTTATCCAGTCCACTGTTGAGG + Intronic
1023778925 7:43637504-43637526 CATTATCCAAGACATCATTAAGG + Intronic
1024466614 7:49717998-49718020 CTTAATCCAGTCTATCATTGAGG - Intergenic
1024854715 7:53764613-53764635 CTTTATCCAGTCTATCACTGAGG + Intergenic
1026609114 7:71841609-71841631 CTTTATCCAGTCCACCATCTAGG - Intronic
1027636749 7:80685855-80685877 CTTAATCCAGTCTATCATTGAGG - Intergenic
1027686584 7:81286216-81286238 CTTAATCCAGTCTATCATTGAGG - Intergenic
1027833975 7:83217952-83217974 CTTTATCCAGTCTATCATTGAGG + Intergenic
1028371071 7:90092911-90092933 CTTTATCCAGTCCACCATGGTGG - Intergenic
1028389765 7:90301712-90301734 CTTTATCCAGTCTGTCATGATGG + Intronic
1028390877 7:90315361-90315383 CTTTATCCAGTCTGTCATGATGG - Intergenic
1029869604 7:103676647-103676669 CTTAATCCAGTCTATCATTGTGG - Intronic
1030390764 7:108925426-108925448 CTTTATCCAGTATAACATTGTGG + Intergenic
1030407640 7:109134148-109134170 CTTTATTCAGTCCACTGTTAGGG - Intergenic
1030611801 7:111697925-111697947 CTTTATCCTGCACTTCATTATGG + Intergenic
1030774262 7:113514056-113514078 CTTAATCCAGTCTATCATTGTGG + Intergenic
1031245007 7:119300420-119300442 CTTTATCCAGTCTATCATTGAGG + Intergenic
1031502926 7:122544183-122544205 CTTTATCCATTTCATCAAAATGG - Intronic
1031544353 7:123033534-123033556 CTTCATCCAGTCCACCATTGAGG - Intergenic
1031912262 7:127530616-127530638 CTTTATCCAATCCACCACTGAGG - Intergenic
1032954335 7:136952961-136952983 CTTTATTCAGTCTATCATTATGG + Intronic
1033435564 7:141330508-141330530 CTTTATCCAGTCTATATTGAAGG + Intronic
1033551087 7:142448817-142448839 CTTTATCCATTCTGTCATTGAGG - Intergenic
1034781191 7:153884393-153884415 CTTAATCCAGTCTATCATGTTGG + Intergenic
1034860474 7:154590898-154590920 CCTTGTCGAGGCCATCATTATGG - Intronic
1035103701 7:156423010-156423032 CTTTATCCAATCCACCATTTAGG + Intergenic
1035646846 8:1230386-1230408 ATTCCTCCAGTCCATCATCATGG - Intergenic
1036438971 8:8763163-8763185 CTTAATCCAGTCTATCATTGTGG - Intergenic
1037195899 8:16188893-16188915 CTTTACCCAGTCTATCACTGAGG + Intronic
1037739746 8:21598789-21598811 CTTTATCCAGTCTATCCCTATGG - Intergenic
1038261036 8:25994544-25994566 CCTTATCCAGTTCACCATTTTGG - Intronic
1038651251 8:29405465-29405487 CTTTATCCAGTTCACCACTGGGG + Intergenic
1038895217 8:31775202-31775224 CCTTATCCAGTCCTCCATGATGG - Intronic
1039674073 8:39640412-39640434 CTTTATCCAGTCTATCTTGGTGG + Intronic
1039821046 8:41135881-41135903 CTTTATCCAGTCTATCTTGATGG - Intergenic
1040538177 8:48327991-48328013 CTTTATCCAGTCTATCATTGAGG - Intergenic
1040723464 8:50353013-50353035 CTTAATCCAGTCTATCATTGAGG - Intronic
1041963124 8:63642922-63642944 CCTTATCCATTCCATCCTCAAGG + Intergenic
1042367048 8:67949548-67949570 CTGGATCCTGTCCATCATTTTGG + Intergenic
1043133648 8:76493105-76493127 CTTTGTCCAGTCCAACATCCTGG + Intergenic
1043180088 8:77077545-77077567 CTTTATCCAGTTTATCATTGTGG + Intergenic
1043243923 8:77974138-77974160 CTTAATCCAGTCTATCATTATGG + Intergenic
1044033519 8:87268336-87268358 CTTTATCCAGTCCACCATGATGG + Intronic
1044040596 8:87363237-87363259 CTTTATCCAGTCTATCAATTGGG + Intronic
1044823500 8:96175380-96175402 CTTAATCCAGTCTATCATTGTGG - Intergenic
1045212606 8:100114031-100114053 CTTTATCCAGTCTATACTGATGG - Intronic
1045554233 8:103200041-103200063 CTTTATCTAGTCTATCACCAAGG + Intronic
1045606522 8:103783650-103783672 CTTAATCCAGTCTATCATTGTGG + Intronic
1046437952 8:114218435-114218457 CTTTACCCAGTGAAACATTATGG + Intergenic
1046496583 8:115022442-115022464 CTTAATCCAGTCTATCAATGTGG + Intergenic
1046499249 8:115054514-115054536 CTTTATCCAATCTGTCATTGAGG + Intergenic
1046709347 8:117492367-117492389 CTTTATCCAGTCTATCATTGGGG - Intergenic
1046947131 8:119984651-119984673 CTTTATTCAGTCTATCATTGAGG + Intronic
1048637271 8:136310955-136310977 CTTTATCCATTAGATCATAATGG + Intergenic
1048658100 8:136565255-136565277 CTTTATCAAGTCCACAATTGAGG + Intergenic
1050010194 9:1178265-1178287 CCTCATCCAGTCTATCATGATGG - Intergenic
1050263078 9:3861543-3861565 CTTTATCCGGTCTATCTTGATGG - Intronic
1050925818 9:11261626-11261648 CTTTATCTAATCTATCACTATGG - Intergenic
1050942147 9:11472680-11472702 AATTATCTAGTCCATCAATATGG - Intergenic
1051511271 9:17880697-17880719 CTATATTCCGTCCATCCTTATGG - Intergenic
1051875848 9:21792565-21792587 CTTTATCCATTCATTCATAATGG - Intergenic
1052151514 9:25122769-25122791 CTTTACCCAGTCGATCATTGAGG + Intergenic
1052152236 9:25131350-25131372 CTTAATCCAGTCCATCATGTTGG - Intergenic
1052445643 9:28557754-28557776 CTTAATCCAGTCTATCATTTTGG - Intronic
1052582976 9:30384995-30385017 CTGTTTCCAGTCTATCATGATGG + Intergenic
1052688745 9:31787810-31787832 CTTTCTCCATACCAGCATTAAGG - Intergenic
1052732152 9:32300551-32300573 CTTTACCCAGTCCTTCATCTAGG + Intergenic
1052875482 9:33558579-33558601 TTTTATCCTGTCTATCATTATGG + Intronic
1054971549 9:71093844-71093866 CTTTATCCAGTCTATCTTGATGG - Intronic
1056388004 9:86115491-86115513 CTTAATCCAGTCTATCATTGAGG - Intergenic
1057376630 9:94530475-94530497 CTTTATCCAGTCTATCATTGAGG - Intergenic
1057697473 9:97335561-97335583 CTTAATCCAGTCTATCATTCTGG + Intronic
1057856670 9:98606156-98606178 CTTAATCCAGTGTATCATTGAGG + Intronic
1058400658 9:104615275-104615297 CTTAATCCAGTCTATCATTATGG - Intergenic
1059712122 9:116878311-116878333 CTTTATCCAGTCTGTCATGACGG - Intronic
1059955085 9:119507550-119507572 CTTTATCCAGTCTATCCCGATGG - Intronic
1061129597 9:128701478-128701500 TTTTTTCCAGTCCATTATGAAGG + Intergenic
1185544301 X:929879-929901 CTTTATCCAGTCTGTCATTGAGG + Intergenic
1185749891 X:2602514-2602536 CTTTATCCAGCCTATTATTTAGG - Intergenic
1185908444 X:3959822-3959844 CTTTATCTAGTCCATGTTGATGG + Intergenic
1186082380 X:5947063-5947085 CTTTATCCAGTCTACCACTGAGG + Intronic
1186498343 X:10030500-10030522 GTATATGCAGTCCATCATTTCGG - Intronic
1186894611 X:13993316-13993338 CTATATCCTGTGCATCATGATGG - Intergenic
1187189085 X:17015794-17015816 CTTAATCCAGTCTATCATTGTGG + Intronic
1187292051 X:17964053-17964075 CTTTATCCAGTCCACCATTATGG + Intergenic
1187640249 X:21279844-21279866 CTTTATCCAGTCTATCATTGAGG + Intergenic
1188171934 X:26938353-26938375 CTTTATCCAGTCTATCATTTAGG - Intergenic
1188329930 X:28857052-28857074 CTTTCTCCATTTCATCAATAAGG - Intronic
1188510168 X:30927392-30927414 CTTTATCCAGTCTATCATTGAGG - Intronic
1188698387 X:33226706-33226728 TTTTACCCAGTCCCTCCTTAAGG - Intronic
1190519166 X:51259683-51259705 CTTAATCCAGTCTATCATTGTGG + Intergenic
1190705026 X:53020421-53020443 TTTTATCCAGTCCACCATGCTGG - Intergenic
1190959582 X:55233207-55233229 CTTTATCCAATCTATCATTGAGG - Intronic
1191270268 X:58456332-58456354 CTTAATTCAGTCTATCATTGTGG + Intergenic
1191822239 X:65323576-65323598 CATTATCCAGTCTACCATTGAGG + Intergenic
1191906864 X:66102675-66102697 CTTAATCCAGTCTATCATTGAGG + Intergenic
1191985732 X:66978641-66978663 CTTAATCCACTCTATCATTGAGG - Intergenic
1192300063 X:69891520-69891542 CTTTATCCAGTCTATGGTTGAGG - Intronic
1192389300 X:70708555-70708577 CTTTATCCAATCCACCATTGAGG - Intronic
1192911830 X:75612796-75612818 CTGTATCCAGTCTATCTTGATGG + Intergenic
1193263807 X:79443248-79443270 CTTTGTCCAGTCCATTGTCATGG + Intergenic
1193584542 X:83304649-83304671 TTTTATCCATTCATTCATTATGG + Intergenic
1193664224 X:84296368-84296390 CTTTATCCAGTCTGTCATTTAGG + Intergenic
1193670202 X:84375502-84375524 CTTAATCCAGTCTATCGTTTTGG - Intronic
1193879418 X:86902924-86902946 CTTTATCCAATCTATAATTGAGG - Intergenic
1193906124 X:87246447-87246469 CTTTATCCAGTGCACCCTTCAGG + Intergenic
1194101221 X:89706735-89706757 CTGTTTTCAGTCCCTCATTAGGG + Intergenic
1194359705 X:92934661-92934683 CTTTATCCAGTCCACCATCATGG - Intergenic
1194552084 X:95313320-95313342 CTTAATCCAGTCTATCATTGAGG + Intergenic
1195481551 X:105351388-105351410 CTTTATCCAGTCTATCACTATGG - Intronic
1195534585 X:105997000-105997022 CTTTATCCAGTCTATCTTGAAGG - Intergenic
1195541079 X:106063626-106063648 CTTTATCCAGTCTATCATTTGGG + Intergenic
1195972093 X:110484052-110484074 CTTTATCCAGTCTATCATTGAGG - Intergenic
1196870078 X:120104823-120104845 CTTTATCCAGTCTATCATCGAGG - Intergenic
1197002796 X:121458330-121458352 CTTTCTCATGTCTATCATTAAGG - Intergenic
1197638553 X:128943063-128943085 CTTAATCCAGTCTATCATTGGGG + Intergenic
1197830823 X:130640510-130640532 CTTTATCCAGTCTATCATTGAGG - Intronic
1198165928 X:134057021-134057043 CTTAATCCAGTCTATCATTGAGG + Intergenic
1198410994 X:136368002-136368024 CTGTATCCATTCCACCATCAGGG + Intronic
1198572871 X:137976716-137976738 CGTTATCCAGTCTATTATTGTGG - Intergenic
1198610420 X:138393688-138393710 CTTTATCCAGTCTGTCATTTTGG - Intergenic
1199152547 X:144504529-144504551 CTTAATCCAGTCTATCATTGTGG - Intergenic
1199361488 X:146924649-146924671 CTTTATCCAGTCCAACATTGAGG + Intergenic
1199398672 X:147370947-147370969 CTTTATGCAATCTATCATTATGG + Intergenic
1199434573 X:147798828-147798850 CTTTAACCAGTCAATCAATGAGG - Intergenic
1200405107 Y:2802139-2802161 CTTTATCAAGTCTATCATTATGG + Intergenic
1200454173 Y:3367821-3367843 CTGTTTTCAGTCCCTCATTAGGG + Intergenic
1200667902 Y:6050486-6050508 CTTTATCCAGTCCACCATCATGG - Intergenic
1200737929 Y:6820460-6820482 CTTTAACCAGTCTATCATAAAGG - Intergenic
1201405631 Y:13646845-13646867 CTTTATCCAGTCTATCATTGAGG + Intergenic
1201521630 Y:14881754-14881776 CTTTATCGAGTCTATCACTGAGG + Intergenic
1201704610 Y:16922384-16922406 CTTTATCCAGTCTATCATTGAGG + Intergenic