ID: 1138884910

View in Genome Browser
Species Human (GRCh38)
Location 16:61064900-61064922
Sequence AATGTGGCTCATATACATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138884905_1138884910 10 Left 1138884905 16:61064867-61064889 CCAAATGCCCATAATGATGGACT No data
Right 1138884910 16:61064900-61064922 AATGTGGCTCATATACATCATGG No data
1138884908_1138884910 2 Left 1138884908 16:61064875-61064897 CCATAATGATGGACTGGATAAAG 0: 2
1: 10
2: 81
3: 198
4: 294
Right 1138884910 16:61064900-61064922 AATGTGGCTCATATACATCATGG No data
1138884904_1138884910 11 Left 1138884904 16:61064866-61064888 CCCAAATGCCCATAATGATGGAC No data
Right 1138884910 16:61064900-61064922 AATGTGGCTCATATACATCATGG No data
1138884907_1138884910 3 Left 1138884907 16:61064874-61064896 CCCATAATGATGGACTGGATAAA 0: 2
1: 25
2: 687
3: 18256
4: 15865
Right 1138884910 16:61064900-61064922 AATGTGGCTCATATACATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138884910 Original CRISPR AATGTGGCTCATATACATCA TGG Intergenic
No off target data available for this crispr