ID: 1138888711

View in Genome Browser
Species Human (GRCh38)
Location 16:61114527-61114549
Sequence GGGATCTGGGTAATATATCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138888701_1138888711 30 Left 1138888701 16:61114474-61114496 CCTGTCAGCAACATCAGCTGCAG No data
Right 1138888711 16:61114527-61114549 GGGATCTGGGTAATATATCACGG No data
1138888706_1138888711 -7 Left 1138888706 16:61114511-61114533 CCTTCATTCCCGAATGGGGATCT No data
Right 1138888711 16:61114527-61114549 GGGATCTGGGTAATATATCACGG No data
1138888705_1138888711 -6 Left 1138888705 16:61114510-61114532 CCCTTCATTCCCGAATGGGGATC No data
Right 1138888711 16:61114527-61114549 GGGATCTGGGTAATATATCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138888711 Original CRISPR GGGATCTGGGTAATATATCA CGG Intergenic
No off target data available for this crispr