ID: 1138890836

View in Genome Browser
Species Human (GRCh38)
Location 16:61142466-61142488
Sequence AGGGAGAGTGCAGAGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138890836_1138890845 10 Left 1138890836 16:61142466-61142488 CCCACAATCTCTGCACTCTCCCT No data
Right 1138890845 16:61142499-61142521 AACAGATTCTCCCTGTCACGTGG No data
1138890836_1138890850 22 Left 1138890836 16:61142466-61142488 CCCACAATCTCTGCACTCTCCCT No data
Right 1138890850 16:61142511-61142533 CTGTCACGTGGCCACTGCTGGGG No data
1138890836_1138890852 30 Left 1138890836 16:61142466-61142488 CCCACAATCTCTGCACTCTCCCT No data
Right 1138890852 16:61142519-61142541 TGGCCACTGCTGGGGAATGGAGG No data
1138890836_1138890847 20 Left 1138890836 16:61142466-61142488 CCCACAATCTCTGCACTCTCCCT No data
Right 1138890847 16:61142509-61142531 CCCTGTCACGTGGCCACTGCTGG No data
1138890836_1138890849 21 Left 1138890836 16:61142466-61142488 CCCACAATCTCTGCACTCTCCCT No data
Right 1138890849 16:61142510-61142532 CCTGTCACGTGGCCACTGCTGGG No data
1138890836_1138890851 27 Left 1138890836 16:61142466-61142488 CCCACAATCTCTGCACTCTCCCT No data
Right 1138890851 16:61142516-61142538 ACGTGGCCACTGCTGGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138890836 Original CRISPR AGGGAGAGTGCAGAGATTGT GGG (reversed) Intergenic
No off target data available for this crispr