ID: 1138902079

View in Genome Browser
Species Human (GRCh38)
Location 16:61285024-61285046
Sequence ATATTTGTACTGATGGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138902079_1138902081 -10 Left 1138902079 16:61285024-61285046 CCTTGAACCATCAGTACAAATAT No data
Right 1138902081 16:61285037-61285059 GTACAAATATCTGCATAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138902079 Original CRISPR ATATTTGTACTGATGGTTCA AGG (reversed) Intergenic
No off target data available for this crispr