ID: 1138902439

View in Genome Browser
Species Human (GRCh38)
Location 16:61289506-61289528
Sequence AAGGGCAGTTCATACAGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138902439_1138902443 4 Left 1138902439 16:61289506-61289528 CCGGCACTGTATGAACTGCCCTT No data
Right 1138902443 16:61289533-61289555 TAGCTTTTGTTAAGAAAGCTTGG No data
1138902439_1138902445 9 Left 1138902439 16:61289506-61289528 CCGGCACTGTATGAACTGCCCTT No data
Right 1138902445 16:61289538-61289560 TTTGTTAAGAAAGCTTGGTAGGG No data
1138902439_1138902444 8 Left 1138902439 16:61289506-61289528 CCGGCACTGTATGAACTGCCCTT No data
Right 1138902444 16:61289537-61289559 TTTTGTTAAGAAAGCTTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138902439 Original CRISPR AAGGGCAGTTCATACAGTGC CGG (reversed) Intergenic
No off target data available for this crispr