ID: 1138903639

View in Genome Browser
Species Human (GRCh38)
Location 16:61303947-61303969
Sequence GTGGCTGGTGTGAATGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138903639_1138903645 17 Left 1138903639 16:61303947-61303969 CCCTGCTCATTCACACCAGCCAC No data
Right 1138903645 16:61303987-61304009 TCTTTGAAAATGTTTTCATGGGG No data
1138903639_1138903646 18 Left 1138903639 16:61303947-61303969 CCCTGCTCATTCACACCAGCCAC No data
Right 1138903646 16:61303988-61304010 CTTTGAAAATGTTTTCATGGGGG No data
1138903639_1138903644 16 Left 1138903639 16:61303947-61303969 CCCTGCTCATTCACACCAGCCAC No data
Right 1138903644 16:61303986-61304008 ATCTTTGAAAATGTTTTCATGGG No data
1138903639_1138903643 15 Left 1138903639 16:61303947-61303969 CCCTGCTCATTCACACCAGCCAC No data
Right 1138903643 16:61303985-61304007 AATCTTTGAAAATGTTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138903639 Original CRISPR GTGGCTGGTGTGAATGAGCA GGG (reversed) Intergenic
No off target data available for this crispr