ID: 1138903659

View in Genome Browser
Species Human (GRCh38)
Location 16:61304165-61304187
Sequence GAGAGCTAAAATTCACATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138903659_1138903663 25 Left 1138903659 16:61304165-61304187 CCCACATGTGAATTTTAGCTCTC No data
Right 1138903663 16:61304213-61304235 GTGATTTTTCTTTGCTAACAGGG No data
1138903659_1138903662 24 Left 1138903659 16:61304165-61304187 CCCACATGTGAATTTTAGCTCTC No data
Right 1138903662 16:61304212-61304234 TGTGATTTTTCTTTGCTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138903659 Original CRISPR GAGAGCTAAAATTCACATGT GGG (reversed) Intergenic
No off target data available for this crispr