ID: 1138904002

View in Genome Browser
Species Human (GRCh38)
Location 16:61308213-61308235
Sequence GTAGCACCCTTGACCCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138903995_1138904002 23 Left 1138903995 16:61308167-61308189 CCAGGATCATGAGACTTACAAGT No data
Right 1138904002 16:61308213-61308235 GTAGCACCCTTGACCCTGTGGGG No data
1138903998_1138904002 0 Left 1138903998 16:61308190-61308212 CCGAGGTCAAACAGACTGGCCTT No data
Right 1138904002 16:61308213-61308235 GTAGCACCCTTGACCCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138904002 Original CRISPR GTAGCACCCTTGACCCTGTG GGG Intergenic
No off target data available for this crispr