ID: 1138915314

View in Genome Browser
Species Human (GRCh38)
Location 16:61456111-61456133
Sequence GCATCAGTGTTAGTGGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138915314_1138915317 -6 Left 1138915314 16:61456111-61456133 CCTGGACCCACTAACACTGATGC No data
Right 1138915317 16:61456128-61456150 TGATGCCAGCATATACTGCATGG No data
1138915314_1138915318 -5 Left 1138915314 16:61456111-61456133 CCTGGACCCACTAACACTGATGC No data
Right 1138915318 16:61456129-61456151 GATGCCAGCATATACTGCATGGG No data
1138915314_1138915320 8 Left 1138915314 16:61456111-61456133 CCTGGACCCACTAACACTGATGC No data
Right 1138915320 16:61456142-61456164 ACTGCATGGGACACAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138915314 Original CRISPR GCATCAGTGTTAGTGGGTCC AGG (reversed) Intergenic
No off target data available for this crispr