ID: 1138925216

View in Genome Browser
Species Human (GRCh38)
Location 16:61581877-61581899
Sequence GCAGCGGTGCCACCTGTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138925208_1138925216 1 Left 1138925208 16:61581853-61581875 CCTGCCCCTCCAACTTGGTGGAG No data
Right 1138925216 16:61581877-61581899 GCAGCGGTGCCACCTGTTCCCGG No data
1138925205_1138925216 17 Left 1138925205 16:61581837-61581859 CCGGAAGTGCGGGCTTCCTGCCC No data
Right 1138925216 16:61581877-61581899 GCAGCGGTGCCACCTGTTCCCGG No data
1138925212_1138925216 -4 Left 1138925212 16:61581858-61581880 CCCTCCAACTTGGTGGAGGGCAG No data
Right 1138925216 16:61581877-61581899 GCAGCGGTGCCACCTGTTCCCGG No data
1138925211_1138925216 -3 Left 1138925211 16:61581857-61581879 CCCCTCCAACTTGGTGGAGGGCA No data
Right 1138925216 16:61581877-61581899 GCAGCGGTGCCACCTGTTCCCGG No data
1138925215_1138925216 -8 Left 1138925215 16:61581862-61581884 CCAACTTGGTGGAGGGCAGCGGT No data
Right 1138925216 16:61581877-61581899 GCAGCGGTGCCACCTGTTCCCGG No data
1138925213_1138925216 -5 Left 1138925213 16:61581859-61581881 CCTCCAACTTGGTGGAGGGCAGC No data
Right 1138925216 16:61581877-61581899 GCAGCGGTGCCACCTGTTCCCGG No data
1138925204_1138925216 18 Left 1138925204 16:61581836-61581858 CCCGGAAGTGCGGGCTTCCTGCC No data
Right 1138925216 16:61581877-61581899 GCAGCGGTGCCACCTGTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138925216 Original CRISPR GCAGCGGTGCCACCTGTTCC CGG Intergenic
No off target data available for this crispr