ID: 1138925480

View in Genome Browser
Species Human (GRCh38)
Location 16:61585179-61585201
Sequence TTCCAAAGAAACCACAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138925480_1138925482 7 Left 1138925480 16:61585179-61585201 CCTTCACTGTGGTTTCTTTGGAA No data
Right 1138925482 16:61585209-61585231 AGTGAGACAAGAAAAGCAGAGGG No data
1138925480_1138925481 6 Left 1138925480 16:61585179-61585201 CCTTCACTGTGGTTTCTTTGGAA No data
Right 1138925481 16:61585208-61585230 GAGTGAGACAAGAAAAGCAGAGG No data
1138925480_1138925484 12 Left 1138925480 16:61585179-61585201 CCTTCACTGTGGTTTCTTTGGAA No data
Right 1138925484 16:61585214-61585236 GACAAGAAAAGCAGAGGGGTTGG No data
1138925480_1138925485 13 Left 1138925480 16:61585179-61585201 CCTTCACTGTGGTTTCTTTGGAA No data
Right 1138925485 16:61585215-61585237 ACAAGAAAAGCAGAGGGGTTGGG No data
1138925480_1138925483 8 Left 1138925480 16:61585179-61585201 CCTTCACTGTGGTTTCTTTGGAA No data
Right 1138925483 16:61585210-61585232 GTGAGACAAGAAAAGCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138925480 Original CRISPR TTCCAAAGAAACCACAGTGA AGG (reversed) Intergenic
No off target data available for this crispr