ID: 1138926886

View in Genome Browser
Species Human (GRCh38)
Location 16:61603239-61603261
Sequence TTCGAAACCTGGGCTAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138926882_1138926886 4 Left 1138926882 16:61603212-61603234 CCACAGGAAGCAAGGGCAGGATT No data
Right 1138926886 16:61603239-61603261 TTCGAAACCTGGGCTAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138926886 Original CRISPR TTCGAAACCTGGGCTAAAAG AGG Intergenic
No off target data available for this crispr