ID: 1138928878

View in Genome Browser
Species Human (GRCh38)
Location 16:61627808-61627830
Sequence AGCTTTAACCTGCAAATTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138928878_1138928879 5 Left 1138928878 16:61627808-61627830 CCTCTAATTTGCAGGTTAAAGCT No data
Right 1138928879 16:61627836-61627858 CATAAGTTTAGTAAATATCTAGG No data
1138928878_1138928880 6 Left 1138928878 16:61627808-61627830 CCTCTAATTTGCAGGTTAAAGCT No data
Right 1138928880 16:61627837-61627859 ATAAGTTTAGTAAATATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138928878 Original CRISPR AGCTTTAACCTGCAAATTAG AGG (reversed) Intergenic
No off target data available for this crispr