ID: 1138930513

View in Genome Browser
Species Human (GRCh38)
Location 16:61649743-61649765
Sequence CATAAGGACTGAAGGCAAGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138930513_1138930517 -3 Left 1138930513 16:61649743-61649765 CCTACTTGCCTTCAGTCCTTATG 0: 1
1: 0
2: 2
3: 12
4: 170
Right 1138930517 16:61649763-61649785 ATGTGGCTATAAAGAGTAATTGG 0: 1
1: 0
2: 2
3: 19
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138930513 Original CRISPR CATAAGGACTGAAGGCAAGT AGG (reversed) Exonic
903082963 1:20826803-20826825 AATAAGGACTAAAGTCAAGTAGG + Intronic
903301721 1:22383856-22383878 CCTTAGGACTGAGGGCAAGGAGG + Intergenic
906732112 1:48091804-48091826 CCCAAGGGCTGAAGGGAAGTTGG - Intergenic
907725153 1:57013510-57013532 CATATGGCCTGAGTGCAAGTGGG + Intronic
911002948 1:93185626-93185648 CATAAGGAGAGGAGGGAAGTGGG + Intronic
911461854 1:98201441-98201463 AAAAAGGAGAGAAGGCAAGTGGG + Intergenic
911774560 1:101791774-101791796 CATAGGGACAGGAGGCATGTGGG + Intergenic
912189334 1:107319245-107319267 CAGAAGGACTTGAGGCAAGGAGG + Intronic
912898530 1:113621212-113621234 CGAAAGGCCAGAAGGCAAGTAGG + Intronic
913288446 1:117249736-117249758 CATCAGGAATGAAAGCCAGTAGG - Intergenic
915015805 1:152732269-152732291 CATAAGGACTCAGGGGAATTAGG - Intergenic
916316313 1:163452043-163452065 CAAAGAGACTGAAGGCAAGGTGG + Intergenic
917027924 1:170662566-170662588 CGCAAGGACTAAAGGCAGGTTGG - Intergenic
917203700 1:172545872-172545894 CAGAAGGACGGAAGGCAGGCAGG - Intronic
917238353 1:172919075-172919097 CCTAAGGACTAAATGCAAGAAGG + Intergenic
919932214 1:202228750-202228772 CATAGGGACTGAAGGTAGATAGG + Intronic
920227936 1:204451380-204451402 CCCAAGGACTGAAGGGAAGAGGG - Intronic
920825834 1:209423648-209423670 CAGAAGGCTTGCAGGCAAGTTGG + Intergenic
924585348 1:245356676-245356698 AATAATGCCTGAAGTCAAGTAGG - Intronic
1063455495 10:6179612-6179634 CAGGAGGACTGCAGGCAAGAGGG + Intronic
1063990297 10:11554124-11554146 CAGAAGGAGTGAAGGAAGGTGGG + Intronic
1064634930 10:17355642-17355664 CATAATGAATGAAAGCAAGTTGG - Intronic
1067665144 10:48271195-48271217 CAGAAGGACAGGAGGCAAGGGGG - Intronic
1070246854 10:74740164-74740186 CACAAAGGCTGAAGACAAGTGGG + Intergenic
1070463365 10:76691875-76691897 CATAAGGTCTGAATGCCTGTGGG - Intergenic
1070851056 10:79561748-79561770 CATAGGGCCTGAAGGCTATTTGG - Intergenic
1070856143 10:79609507-79609529 CATAGGGCCTGAAGGCTATTTGG + Intergenic
1071257419 10:83884020-83884042 AATAATGACGGAAGGCAAATCGG - Intergenic
1072765966 10:98095473-98095495 CATAAGGGCTGAAGGAGAGAAGG + Intergenic
1073754323 10:106564885-106564907 CATAAGAGTTCAAGGCAAGTTGG + Intergenic
1075501947 10:122982828-122982850 CAACAGGACTGAAGCCATGTGGG + Exonic
1077108444 11:851784-851806 CAGAATGACTGAAGGGCAGTGGG + Intronic
1077785577 11:5380157-5380179 CATAATGACTGAAGAGAGGTAGG + Intronic
1081864005 11:46349779-46349801 GATAAGGTTTGAAGTCAAGTTGG + Intronic
1082728249 11:56763598-56763620 CATAAAGACAGAAGGAAAGAAGG - Intergenic
1083785088 11:64940357-64940379 CAGAAGGAGTGAAGGGAGGTAGG - Intronic
1085749073 11:79144078-79144100 TATAAGGACCTAAGGCAACTCGG + Intronic
1091098812 11:132850234-132850256 CATAACCACTGAGGGCAAGTAGG - Intronic
1091784597 12:3235531-3235553 GACAAGGACTCAAGGGAAGTGGG - Intronic
1092899819 12:13047818-13047840 GAGTAGGACTTAAGGCAAGTTGG + Intronic
1093066069 12:14659616-14659638 CCTAAGACCTGGAGGCAAGTAGG + Intronic
1093834961 12:23817590-23817612 CATAAGCACTTAAAGCAAATTGG + Intronic
1095944411 12:47745947-47745969 CCAAAGGACAGAAAGCAAGTAGG + Intronic
1096362699 12:51001906-51001928 CAAAAGGACTCAAGGGAAGATGG + Intronic
1097123895 12:56757744-56757766 CATAAGGACTGAAGGAAAAAAGG - Intronic
1098067304 12:66632274-66632296 CAGAAGGTCACAAGGCAAGTAGG + Intronic
1098542476 12:71672112-71672134 CATCAAGACTTAAGGCAAGAAGG - Intronic
1102939608 12:116927795-116927817 TATAAGGAGTGAAGGCGTGTGGG + Intronic
1104500942 12:129284874-129284896 CATAGAGACTGAAGGCAGATTGG + Intronic
1105285102 13:18996950-18996972 CAGAAGGTGTGAAGGCAAGAAGG + Intergenic
1108916846 13:55624319-55624341 CATAAGGTCTGACTGCCAGTGGG - Intergenic
1109167831 13:59057661-59057683 CAAAAAGACTGAAGAAAAGTAGG - Intergenic
1109859707 13:68180588-68180610 CATTATGACTGAAGGCATGGAGG - Intergenic
1110266693 13:73545729-73545751 AATAAACACTGAAGGCAACTGGG - Intergenic
1112081136 13:95972237-95972259 GATAAGGACTGAAGTCAACATGG - Intronic
1112214898 13:97420021-97420043 CTTGAGGAATGGAGGCAAGTTGG + Intergenic
1113454687 13:110439820-110439842 CACCAGGACAGAAGGTAAGTTGG + Exonic
1114763481 14:25344270-25344292 CATAAGGTCTGACTGCCAGTGGG - Intergenic
1118299552 14:64602897-64602919 GATAATGACTGTTGGCAAGTGGG + Intergenic
1119086519 14:71744171-71744193 TCACAGGACTGAAGGCAAGTGGG - Intergenic
1119932130 14:78557589-78557611 CATAAGAACTAAAGGCCACTAGG - Intronic
1121889820 14:97579108-97579130 CATAAGGTTAGAAGGCAAGTGGG - Intergenic
1130847090 15:87757727-87757749 CAAAATGAATGAAGACAAGTAGG - Intergenic
1131222828 15:90599055-90599077 CATCAGGACGGAAGGCAAAGGGG + Intronic
1131898355 15:97059197-97059219 CAAAATGACTGAATGCAAATTGG - Intergenic
1133499240 16:6349865-6349887 GATAAGAAAGGAAGGCAAGTTGG + Intronic
1134388394 16:13795425-13795447 CATAAGGAATGATGGGAAATTGG + Intergenic
1137893910 16:52190502-52190524 CATAAGGACAGAGGGTAAGAAGG + Intergenic
1138930513 16:61649743-61649765 CATAAGGACTGAAGGCAAGTAGG - Exonic
1140448945 16:75054491-75054513 CATAGGGTCTGCAGGGAAGTGGG + Intronic
1142189350 16:88710681-88710703 CAAATGGACAGAAGTCAAGTGGG - Intronic
1151633284 17:75326020-75326042 CCTAAGGAAGGAAGGCAAGCTGG + Exonic
1153464445 18:5373793-5373815 CATAGGAACTGAAGTCAAGCTGG + Intergenic
1153586083 18:6622001-6622023 CAGAGGGACTGAAGGCACTTTGG + Intergenic
1154051580 18:10964787-10964809 CATAAGGACAGAAAGCAGATTGG - Intronic
1155457912 18:26040729-26040751 CAGAAGCACGGAAGGCAAATAGG - Intronic
1155932525 18:31722677-31722699 CAGATGAAATGAAGGCAAGTAGG - Intergenic
1156133675 18:34009013-34009035 CATGAGGAATGAGGGCAAGATGG - Intronic
1158028152 18:52928709-52928731 CAGAAGCACAGAAGGCAAGAGGG - Intronic
1158901487 18:61966010-61966032 CATAAAGACAGAAGGCAAATTGG - Intergenic
1160612781 18:80101529-80101551 CATACGGCCTGAAGGGGAGTGGG - Intergenic
1161982342 19:7636728-7636750 CTGAAGTACAGAAGGCAAGTGGG + Intronic
1165196740 19:34109988-34110010 CATAAGGAATCAAGGCATATGGG + Intergenic
1166860284 19:45806341-45806363 GAAAGGGACTGAAGGCAAGCAGG + Intronic
926898342 2:17720427-17720449 CATATAGATGGAAGGCAAGTAGG - Intronic
927369403 2:22337300-22337322 CATAATTAATGAAGGCAAATGGG + Intergenic
927920021 2:26965158-26965180 CATAATAACTGAAGGCAAAGGGG + Intergenic
929953101 2:46431975-46431997 CATAAGCACTGATAGCACGTTGG - Intronic
930541065 2:52707253-52707275 TACAAAGACTGAAGGGAAGTTGG - Intergenic
933600105 2:84320221-84320243 CAAAGGGACTGAAGGAAAGATGG + Intergenic
934713120 2:96528336-96528358 CAGAAGGAGGGAAGGCAAGGGGG + Intergenic
934835537 2:97586430-97586452 CATTAGGACTGAATCCCAGTTGG - Intronic
937457458 2:122054866-122054888 CACAAGGTCTGAGGGCAGGTAGG - Intergenic
938762159 2:134435812-134435834 GATAAGGAGATAAGGCAAGTTGG + Intronic
940624861 2:156161317-156161339 CATAAGTACTAAAGACTAGTAGG - Intergenic
942140947 2:172977204-172977226 CCCAAGGACTGAAGGCAATCTGG - Intronic
943088799 2:183349603-183349625 AAAAAACACTGAAGGCAAGTAGG - Intergenic
943728455 2:191276531-191276553 CACAAGGGCTGAGGGAAAGTAGG + Intronic
944041916 2:195365459-195365481 AATAAGGACTGAGGAGAAGTGGG - Intergenic
944515540 2:200509231-200509253 CACAAGGACTGACTGCTAGTAGG + Intronic
945240795 2:207675056-207675078 CATAAGAACAGAAGGCAAGTAGG + Intergenic
945360270 2:208887689-208887711 AATCATGACAGAAGGCAAGTAGG - Intergenic
945723632 2:213448928-213448950 CATAAGGTCTGACTGCCAGTGGG + Intronic
946123819 2:217541398-217541420 CATAATGACTAAATGCAATTTGG + Intronic
947550595 2:231042702-231042724 CATAAGAAATGATCGCAAGTAGG + Intronic
1169643349 20:7779820-7779842 CATAAGAACTGAATGCAGATTGG + Intergenic
1170593470 20:17788215-17788237 CATAAAGACAGAAGGCAGATTGG - Intergenic
1171993468 20:31714521-31714543 CATAAAGACTGGAGCCATGTTGG - Intronic
1173209675 20:41022431-41022453 CCTGAGGAATGAAGGCAAATAGG - Intergenic
1173927198 20:46789650-46789672 CATAAGGTCAGAAGGGAAGTGGG - Intergenic
1175155173 20:56966281-56966303 CATCTGGTCTGAAGGCATGTGGG + Intergenic
1175157255 20:56979445-56979467 CAGAAGGACTGAAGGCAGTGTGG + Intergenic
1178221064 21:30660774-30660796 ACTAAGGACTGGAGGAAAGTGGG + Intergenic
1179124577 21:38579556-38579578 CATGAGGACTGGAGGAAAGAGGG + Intronic
1181295007 22:21830741-21830763 CAGAAGGAATGAAGGAAATTGGG + Intronic
1181868085 22:25875150-25875172 CATGAGCACAGAAGGCCAGTGGG - Intronic
1183696605 22:39427255-39427277 CATGAGGACTGAAGGGAATAAGG - Intronic
1184726176 22:46347951-46347973 CATAAGGAAGGAAGGCGAGGAGG - Intronic
949512325 3:4777361-4777383 TGTTAGAACTGAAGGCAAGTAGG + Exonic
952127247 3:30315393-30315415 CATAAAGATTGATAGCAAGTTGG - Intergenic
953434248 3:42865967-42865989 CAGAAGGAAGGAAGGAAAGTAGG - Exonic
955390894 3:58521508-58521530 CAGAAGGCCTGGAGACAAGTGGG - Intronic
957266721 3:77976259-77976281 CATCAGGAATGAAGGCAAGTGGG - Intergenic
958055030 3:88399161-88399183 CATAAAGACTGAAAGCATTTTGG + Intergenic
959787884 3:110322342-110322364 AATCATGACTGAAGGCAAGGAGG + Intergenic
961356252 3:126341788-126341810 TATAAGAACTGGATGCAAGTCGG - Intergenic
963778170 3:149461279-149461301 CAAAAAGATTGAAGGCAAGTTGG + Intergenic
964415450 3:156443266-156443288 CATAAGGAAGGAAGGTTAGTGGG + Intronic
964512473 3:157467793-157467815 GAAAAGGACTGAAGGCTAGTAGG - Intronic
969136185 4:5030780-5030802 CATATTCACTGAAGGCAAGAAGG + Intergenic
972797720 4:42438667-42438689 CAGATGGACTGAATGCAAGGAGG + Intronic
974444443 4:61961253-61961275 CAGAAGGAGGGAAAGCAAGTGGG - Intronic
981483680 4:145262894-145262916 AATCATGACTGAAGGCAAGGAGG - Intergenic
984407536 4:179352402-179352424 CAGAAAGACTGAAAGCACGTGGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986886887 5:12249667-12249689 CAGGAGGAATGAAGGCAACTGGG - Intergenic
989567775 5:42917824-42917846 TTGAAGGACTGATGGCAAGTAGG + Intergenic
994875839 5:105419705-105419727 CATAAGGTCTGACGGCCTGTGGG - Intergenic
995327881 5:110912190-110912212 CATCAGGATTTAAGGCAAGATGG - Intergenic
995450632 5:112296024-112296046 CAAAATGACAGAAAGCAAGTTGG + Intronic
999892382 5:155993151-155993173 CAGAAGGACTGAAGGGAAAATGG - Intronic
1000515346 5:162231848-162231870 AATCATGACAGAAGGCAAGTAGG - Intergenic
1002007217 5:176245212-176245234 CATAAGGACAGTAGTCATGTTGG - Intronic
1004534805 6:16490285-16490307 GAAAAAGACTGAAGGGAAGTTGG - Intronic
1008392422 6:50968393-50968415 CATAAGTACTGCAGACAAGAAGG - Intergenic
1011437242 6:87351481-87351503 CATGAGTCCTGAAGGCTAGTGGG + Intronic
1014892338 6:126858015-126858037 CATCAGGAATAAAGGCAAGATGG + Intergenic
1016366873 6:143328425-143328447 AAGAAAGACTAAAGGCAAGTGGG + Intronic
1017532286 6:155307369-155307391 AATCATGACGGAAGGCAAGTAGG + Intronic
1018468639 6:164077335-164077357 CATAACTAGTGAAGGCAAATGGG - Intergenic
1019052056 6:169191317-169191339 TATAAGGTCTTAAAGCAAGTCGG - Intergenic
1020426735 7:8075301-8075323 CCTAAAGACTGAAGGGAACTTGG + Intronic
1021109543 7:16677982-16678004 CGTAAGGACTGAAGCCAGCTAGG + Intronic
1022981326 7:35607434-35607456 CATAAGGGCAGATGGCAAATAGG - Intergenic
1023615084 7:42011716-42011738 CATAGAGACAGAAGGCAGGTTGG + Intronic
1028250225 7:88531437-88531459 AATCATGACTGAAGGCAAGGAGG - Intergenic
1028270927 7:88788180-88788202 CATGAGGACTGGAGGCCAGGTGG + Intronic
1037461402 8:19113876-19113898 CACAAGGAACCAAGGCAAGTGGG - Intergenic
1039510651 8:38089389-38089411 AATAAAGACTGAAGGGAAGAAGG - Intergenic
1039906397 8:41789609-41789631 CATTGGGACTGAAGACTAGTGGG + Intronic
1041148122 8:54900948-54900970 TAGAAGGAATGAAGGAAAGTAGG + Intergenic
1042919694 8:73909196-73909218 CAACAGGACTGAAGGTAACTGGG + Intergenic
1045680057 8:104649364-104649386 CAGAAGCATTTAAGGCAAGTTGG - Intronic
1046151349 8:110230389-110230411 CATAAAGAATGAAGGTAAGTGGG - Intergenic
1046666004 8:117003744-117003766 CATAAGCAGTGAAAGCAAATAGG + Intronic
1049541920 8:143212522-143212544 CACAAGGCCAGAAGGCAGGTGGG + Intergenic
1053365708 9:37521168-37521190 GATGAGGCCTGAGGGCAAGTTGG + Intronic
1058010692 9:99973555-99973577 TATAAGGAATGGAGTCAAGTTGG - Intergenic
1059615612 9:115947774-115947796 CATATGGAATGAATACAAGTTGG + Intergenic
1185699511 X:2219767-2219789 CATAAGGAGTGCAGGCTCGTAGG + Exonic
1185910198 X:3973936-3973958 ATTAAGGACTGAAGGCTGGTGGG + Intergenic
1187049661 X:15683256-15683278 AATAAGGAGTGAATGAAAGTAGG + Intergenic
1187057469 X:15754388-15754410 AATAAGGAGTGAATGAAAGTAGG + Intronic
1189073841 X:37894911-37894933 CCAAAGGACTGAAAACAAGTGGG - Intronic
1190289231 X:48981334-48981356 CATGAGGACTGAGGCCCAGTGGG + Intronic
1190425598 X:50332212-50332234 ATTAAGGACTGAAGACAGGTGGG - Intronic
1190437557 X:50440970-50440992 CATGAGGATTGAAGGCAAATGGG - Intronic
1190787809 X:53669448-53669470 CATAAGGTCTTAAAGCCAGTTGG - Intronic
1193561984 X:83029860-83029882 CATAAGGCCTGACTGCATGTGGG - Intergenic
1194283905 X:91986043-91986065 CATAAGGAATGAAGCCAGATAGG - Intronic
1195662270 X:107391334-107391356 CATAGAGACTGAAGGCAGGTTGG - Intergenic
1199757220 X:150875849-150875871 CATCAGGGCAGAAGGCAAGGAGG - Intronic
1200049915 X:153423230-153423252 CACAAGGCCTGAGGGCAGGTGGG + Intergenic
1200601473 Y:5210600-5210622 CATAAGGAATGAAGCCAGATAGG - Intronic
1202147727 Y:21817448-21817470 CATAGGGACTGGAGCCAAGAGGG - Intergenic