ID: 1138930744

View in Genome Browser
Species Human (GRCh38)
Location 16:61653071-61653093
Sequence GCCTCCTAGATTATACAGTA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138930744 Original CRISPR GCCTCCTAGATTATACAGTA CGG (reversed) Exonic
904017310 1:27432268-27432290 GCCCCCAAGATCACACAGTAAGG - Intronic
904356620 1:29944429-29944451 GCCTCCTAGGGTACACAGTGAGG - Intergenic
904972688 1:34431585-34431607 GCCTCCCAGATTATATCTTAAGG - Intergenic
911399687 1:97359083-97359105 GCCACCTAGAATAAACAGTGTGG + Intronic
918185641 1:182124759-182124781 GCCTCCAAGAGAATACAGTGAGG + Intergenic
1069380282 10:67836424-67836446 ACATGCTAGCTTATACAGTAAGG - Intronic
1070816295 10:79325689-79325711 GACCCCTGGCTTATACAGTAGGG + Intergenic
1071529669 10:86379363-86379385 GCTTCTTAGATTATAGATTAAGG - Intergenic
1073940918 10:108697010-108697032 ACCTCATAAATTATTCAGTAAGG - Intergenic
1075764319 10:124880445-124880467 ACCTTCTTTATTATACAGTAAGG - Intergenic
1076152672 10:128175385-128175407 GCATCCTCTAATATACAGTATGG + Intergenic
1081833542 11:46135088-46135110 GCCTCCCACATTTTACAGAACGG - Intergenic
1090560002 11:127921721-127921743 GCTCCTTAGATGATACAGTAAGG - Intergenic
1100180527 12:92080597-92080619 GCCTCCTAGAGTATTTAGAATGG + Intronic
1101019423 12:100538111-100538133 GGCTCCTAGGTTAGACAATAAGG + Intronic
1101796321 12:107977939-107977961 GCCTCCTTTATTATAAAATAGGG - Intergenic
1109823479 13:67687670-67687692 GCATCCTGGATTATCCAGTTAGG - Intergenic
1112902858 13:104380010-104380032 GTCTCCTAGATTCTCCAGAAAGG - Intergenic
1113059426 13:106306291-106306313 GCCTCCTACATGATGTAGTATGG + Intergenic
1116695210 14:48166606-48166628 TCCTCCTAGATTAAACCATAAGG + Intergenic
1124667527 15:31605969-31605991 GACTCCAAGAGTATACAGAAAGG - Intronic
1125392415 15:39208441-39208463 ACCTACTAGATTCTGCAGTAAGG - Intergenic
1132832943 16:1938337-1938359 GCCTCCGAGCATGTACAGTAAGG + Exonic
1133662794 16:7935221-7935243 GAATCCTAGAGTATAGAGTAGGG + Intergenic
1135245643 16:20854575-20854597 GACCCCTAGATTTAACAGTATGG - Intronic
1138930744 16:61653071-61653093 GCCTCCTAGATTATACAGTACGG - Exonic
1140478163 16:75249285-75249307 GCCTCCTTGATGACACAGTTGGG - Intronic
1150838706 17:68588244-68588266 GCCTCCCAGATGAGACAGTCTGG - Intronic
1151105069 17:71603586-71603608 GCCTACTATTTTAAACAGTAGGG - Intergenic
1154092264 18:11376661-11376683 GCCTCCAAGATAATTCAGTAAGG + Intergenic
1157506878 18:48232718-48232740 GCCTCCTAGTTAATTCAGTAGGG + Intronic
1159070935 18:63623381-63623403 GCAGACAAGATTATACAGTAAGG + Intergenic
1164677343 19:30110431-30110453 GCTTTCTCGATTTTACAGTAAGG - Intergenic
935631890 2:105218831-105218853 GCCTCCTAGAGGATAAAGGAAGG - Intergenic
941503043 2:166305099-166305121 GCCACCTAGACAATACAGAAGGG - Intronic
1170051590 20:12151595-12151617 GCTTCCTCGTTTATACAATAAGG - Intergenic
1171315481 20:24188607-24188629 GCCTCCAAAATAGTACAGTATGG - Intergenic
1173997882 20:47353330-47353352 GCCTCTTGGATTATAAATTAGGG - Intronic
1177851431 21:26353645-26353667 ACATCCTACATTATACAGGATGG + Intergenic
1182231223 22:28838895-28838917 TCTTCCAAGATTATATAGTAAGG - Intergenic
951170426 3:19535376-19535398 GCCTCAGAGATTACACAGTTAGG + Exonic
957875753 3:86144115-86144137 GCCTCCTGGATTATCCAGATGGG - Intergenic
959094517 3:101939314-101939336 GCCTACTAAATTATGGAGTAAGG + Intergenic
961366914 3:126406151-126406173 GCCTCCCCGACTATACATTATGG + Intronic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
980772341 4:137392508-137392530 GTCTCATAGAATAAACAGTATGG - Intergenic
981149971 4:141369162-141369184 TTCTACTAGAGTATACAGTAAGG + Intergenic
981233482 4:142387530-142387552 GCCTCCAAGGTTATATAGTGTGG + Intronic
983652618 4:170048682-170048704 GGCTCCCAGATTCTACATTACGG - Intergenic
985854299 5:2413031-2413053 GCCTCCTAGATTTTACCCTCCGG - Intergenic
988480616 5:31627257-31627279 GCCTCCTAGGACATACAGCAGGG + Intergenic
991939419 5:71836252-71836274 GTCTCCTAGATTGTCCAGAAGGG + Intergenic
993237279 5:85328831-85328853 GCCTCCTAGGATAAAGAGTATGG - Intergenic
994675140 5:102811500-102811522 GTCTCCTAGATTATCCAGGTGGG - Intronic
996689953 5:126329825-126329847 GTCTCTTAGATAAGACAGTATGG + Intergenic
998815196 5:146006907-146006929 GCTTCCTAGTTTCCACAGTAGGG + Intronic
999204501 5:149838362-149838384 GAATCCTAGCTTCTACAGTAAGG - Intronic
1001413215 5:171525237-171525259 GCCTTCTAGAGTACACAGGATGG - Intergenic
1009437943 6:63639264-63639286 GCGTGGTAGATTATACAGAAAGG + Intronic
1009592134 6:65686425-65686447 GGCTCCTTGATCATACAGTAAGG + Intronic
1010961449 6:82150744-82150766 GTTTCCAAGAATATACAGTAGGG + Intergenic
1012324237 6:97894984-97895006 GTTTCCTAGGGTATACAGTATGG - Intergenic
1031558104 7:123203397-123203419 GCTTCCTTGTTTATATAGTATGG + Intergenic
1032916779 7:136499276-136499298 GCCTCCTACATTAGAAAGTATGG - Intergenic
1035755755 8:2030846-2030868 GCCTCCTGGATTGTATACTAGGG - Intergenic
1035984369 8:4410114-4410136 GCTTCAAAGATTATAAAGTATGG - Intronic
1037742753 8:21620505-21620527 GCCTCCCAGAGCACACAGTAGGG + Intergenic
1043240729 8:77931605-77931627 GCCTGCTATATCATTCAGTAGGG - Intergenic
1044487994 8:92775803-92775825 ACCTTCTAGTCTATACAGTAAGG - Intergenic
1045340798 8:101252749-101252771 GCCTCCCAGAGTACACAGGAGGG - Intergenic
1048108921 8:131444630-131444652 GCCTAATAGATTATACATTTTGG + Intergenic
1049691737 8:143964358-143964380 TCATCCTAGATTACCCAGTAGGG + Intronic
1056326243 9:85481168-85481190 GCCTCCTGTATTATGCAGCATGG - Intergenic
1060168564 9:121441509-121441531 TCCTCCTGTAGTATACAGTATGG - Intergenic
1060474703 9:123977987-123978009 TCCTCCTAGATTACACAGGCAGG - Intergenic
1060476659 9:123992136-123992158 TCCTCCTAGATTACACAGGCAGG + Intergenic
1189604646 X:42663436-42663458 GCCTCTCAGATTAAACGGTATGG + Intergenic
1198923947 X:141765769-141765791 GCCTTCTAGTCTATACAATAAGG - Intergenic