ID: 1138930844

View in Genome Browser
Species Human (GRCh38)
Location 16:61653989-61654011
Sequence GCTACGATGATGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138930844_1138930848 23 Left 1138930844 16:61653989-61654011 CCCTCCTCCTTCATCATCGTAGC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1138930848 16:61654035-61654057 TCATCATCTTTGATAATTAATGG 0: 1
1: 0
2: 3
3: 29
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138930844 Original CRISPR GCTACGATGATGAAGGAGGA GGG (reversed) Exonic
902651357 1:17839705-17839727 GCCACGAAGGTGAAAGAGGAGGG + Intergenic
904014388 1:27408805-27408827 GGTGAGATGATGAAGGGGGAGGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907645107 1:56234607-56234629 GTTATGATGATAGAGGAGGATGG - Intergenic
908865263 1:68541716-68541738 GCTAGGTTGCTGAAGGAAGATGG - Intergenic
909333271 1:74441011-74441033 GCTACGATGGTGGTGGATGATGG - Intronic
910081297 1:83345168-83345190 GTTACCATGATGATAGAGGATGG + Intergenic
912182761 1:107238140-107238162 GTCACGATGATGAAAGAGGTGGG - Intronic
921275305 1:213513168-213513190 ACTTTGAAGATGAAGGAGGAGGG + Intergenic
922020783 1:221702351-221702373 GAGACAATGAGGAAGGAGGATGG - Exonic
924184704 1:241475953-241475975 GCAAAGATCAAGAAGGAGGAAGG - Intergenic
1065829669 10:29603228-29603250 GATACGAGGATGAGGGGGGAGGG - Intronic
1071722088 10:88157402-88157424 GCTAGGAAGATGAAGGTAGAAGG - Intergenic
1073267141 10:102234568-102234590 GCTGGGAAGATGAGGGAGGAAGG + Intronic
1073432394 10:103494631-103494653 GCGATGATGGTGATGGAGGATGG + Intronic
1073930135 10:108566389-108566411 GCTGCCATGATGAAGGTGGCGGG + Intergenic
1084650672 11:70487447-70487469 GCCACCATGATGAGGGAGAAGGG - Intronic
1085596891 11:77819708-77819730 GCTGCCAAGATGAAGGGGGAAGG + Intronic
1086368088 11:86128793-86128815 GCCAGGAACATGAAGGAGGAGGG + Intergenic
1086826293 11:91503345-91503367 GCTATGATGATAAAGAAGAAGGG + Intergenic
1089569025 11:119390176-119390198 CCCAAGATGATGAAGGAGAAGGG - Intergenic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1093914117 12:24781529-24781551 GCTTTGAAGATGAAGGAAGATGG - Intergenic
1094487467 12:30936492-30936514 CCTACAATGATAAATGAGGAGGG + Intronic
1095177677 12:39111790-39111812 GATAGGGTGATGGAGGAGGAAGG + Intergenic
1096331903 12:50720675-50720697 GAAAGGATGAGGAAGGAGGATGG + Intronic
1099246620 12:80200425-80200447 GCTTTGAAGATGAAGGAGAAGGG - Intergenic
1099828612 12:87811837-87811859 GAGACAGTGATGAAGGAGGATGG + Intergenic
1100824325 12:98460791-98460813 ACTACGATGATGACAGAGGTTGG - Intergenic
1102806120 12:115782458-115782480 GTCACGAGGATTAAGGAGGAGGG - Intergenic
1106470696 13:30051727-30051749 TCTAGGAGGAAGAAGGAGGAAGG + Intergenic
1107669097 13:42725095-42725117 GCTAGGATGATGAAAGATGTTGG - Intergenic
1110329185 13:74251611-74251633 GGTAGGAAGATGAGGGAGGATGG - Intergenic
1110548080 13:76779226-76779248 GATTCTATGATGAAGGTGGAAGG - Intergenic
1114352438 14:21868069-21868091 AGTACAATGATAAAGGAGGAGGG - Intergenic
1114356697 14:21917454-21917476 AGTACAATGATAAAGGAGGAAGG - Intergenic
1114799506 14:25757497-25757519 GTTAGCATGATAAAGGAGGAAGG - Intergenic
1120457833 14:84754869-84754891 GTTATGATGATGCAGGAGGTGGG - Intergenic
1121108282 14:91295032-91295054 GCGACTATGAGAAAGGAGGATGG + Intronic
1124101456 15:26697984-26698006 TCTAAGATGATGAGGGAGGTGGG - Intronic
1128707958 15:69851250-69851272 GCAGCGATGGTGAAGGAGGCTGG - Intergenic
1133430903 16:5736107-5736129 GCTGCGATGATGACGGCGGGAGG + Intergenic
1133758677 16:8781172-8781194 GCTTCCATGATGGAGGATGATGG + Intronic
1134206118 16:12239148-12239170 GCTTCTGTGATGAAGGAAGAAGG + Intronic
1137525991 16:49236759-49236781 GCTATGAAGATGGAGGAGGGGGG + Intergenic
1138930844 16:61653989-61654011 GCTACGATGATGAAGGAGGAGGG - Exonic
1141250948 16:82358602-82358624 GCTACTTTGAAGATGGAGGAAGG + Intergenic
1142291015 16:89193572-89193594 ACTACGATGAGCAAGGAGGCGGG + Exonic
1203141744 16_KI270728v1_random:1771553-1771575 GCTGGGATGATGGAGGAGGAGGG - Intergenic
1144045878 17:11454244-11454266 GCAGTGATGATGGAGGAGGAGGG - Intronic
1153946630 18:10023768-10023790 GGTAGGATGATGAAGCAGGAGGG + Intergenic
1158919750 18:62178189-62178211 GCCACAATGGTGAATGAGGATGG + Intronic
1159159357 18:64623439-64623461 ACTAAAATGATGATGGAGGATGG + Intergenic
1159410913 18:68073437-68073459 GTCACGCTGATGAAAGAGGAGGG - Intergenic
1161746531 19:6063582-6063604 GCTGCGTTGAAGAAGGAGGGAGG + Intronic
1165672758 19:37693367-37693389 GATACGATGACGATGGAAGAGGG - Intronic
1166583242 19:43922074-43922096 GTTAGGAAGATGAAGGAGAACGG - Intronic
925662017 2:6212773-6212795 GCTGCGGTGCTGAAGGAGCATGG - Intergenic
927869905 2:26616723-26616745 GGTAGGAGGAGGAAGGAGGATGG - Intronic
928735323 2:34282177-34282199 GATATGATGATGTAGGAGAATGG - Intergenic
930751762 2:54941429-54941451 GCTACGCTGAGGAAGGAGCTGGG - Intronic
933690595 2:85176583-85176605 TCTAGGATAATGAAGGATGAGGG - Intronic
933985162 2:87584605-87584627 GATACGATGCTTTAGGAGGAAGG + Intergenic
936285454 2:111177926-111177948 GGTGAGATGAGGAAGGAGGAGGG - Intergenic
936308680 2:111366206-111366228 GATACGATGCTTTAGGAGGAAGG - Intergenic
938206740 2:129430743-129430765 GCAAAGATGTTGAAGGAAGAAGG - Intergenic
939991211 2:148877406-148877428 GCTACGATTATTGATGAGGAAGG + Intronic
946237390 2:218332541-218332563 GCTGAGATGGGGAAGGAGGAAGG - Intronic
948227023 2:236319115-236319137 GCTGCGATGAAGAAGGAGGAGGG - Intergenic
948826116 2:240574132-240574154 GCCACGATGGGGAAGGAGGGTGG - Exonic
1172189211 20:33051814-33051836 GCTAAGATGGGGAAGAAGGATGG - Intergenic
1174015144 20:47481822-47481844 GCTAAGACGATGTAGGAGAAAGG - Intergenic
1181902420 22:26167862-26167884 GCAAGGAAGATGGAGGAGGAGGG - Intergenic
1182865646 22:33601999-33602021 GCTAAGAAGTTGAAGGAGTAAGG - Intronic
1183127210 22:35794785-35794807 GCAAGGATGATGAAGTAGTAAGG - Intronic
1184747425 22:46464502-46464524 GCCAGGGTGCTGAAGGAGGAAGG - Intronic
949647048 3:6107495-6107517 GCTACAAAGATGCAGGAGGAAGG - Intergenic
949650208 3:6149492-6149514 GCTAGGATGATGTCAGAGGAGGG - Intergenic
950493647 3:13320989-13321011 GCATCGCTGATGAGGGAGGAGGG - Intronic
951126526 3:18991005-18991027 CCTAAGAGAATGAAGGAGGAAGG - Intergenic
952127211 3:30315051-30315073 GATATGATGATGAAAGGGGAAGG + Intergenic
953475202 3:43200091-43200113 ACTATGCTGATGAAGAAGGAAGG - Intergenic
959041014 3:101423708-101423730 GCTAGGCTGAAGAGGGAGGAAGG + Intronic
960453556 3:117841458-117841480 GCTACCAGGAAGAAAGAGGAGGG - Intergenic
962844204 3:139260832-139260854 GCTGTGAGCATGAAGGAGGAAGG - Intronic
963068969 3:141286858-141286880 GCTGTGAGGATGAAGGAGAAGGG + Intronic
963791360 3:149586115-149586137 GCTACTTTCATGAAGAAGGATGG - Intronic
964281911 3:155077020-155077042 CATACGATGATGTAGGAGGTCGG - Intronic
964383520 3:156122735-156122757 GCTGCAATAATAAAGGAGGATGG - Intronic
966155208 3:176908937-176908959 GCTAGGCAGATAAAGGAGGAAGG + Intergenic
969673093 4:8600541-8600563 GCTGTGATGAGGAAGCAGGAAGG + Intronic
975785207 4:77880299-77880321 GCTTTGAAGATGAAGGATGAGGG - Intronic
976387685 4:84480277-84480299 GCCAAGATGAGGAAGGAGGTGGG + Intergenic
977688598 4:99877398-99877420 GCTAAGAGGATAAAGGAGGGGGG - Intergenic
978355815 4:107872352-107872374 GCTACGAAGACAAAGCAGGATGG - Intronic
980901782 4:138911976-138911998 GAGACGATGATGATAGAGGATGG - Intergenic
981611698 4:146600131-146600153 ACCACAATGATGAAGGAGAAAGG - Intergenic
982895906 4:160925226-160925248 GCTACAAGGATGAAGGAAAATGG - Intergenic
985328429 4:188798521-188798543 GCTAAGATTATGGTGGAGGATGG + Intergenic
987729620 5:21752124-21752146 ATTACGATGATGAAGGAGGTGGG - Exonic
988799426 5:34682584-34682606 GTTACGTTGATAAATGAGGATGG - Intronic
990319721 5:54617952-54617974 GCGAGGATTATGATGGAGGAAGG + Intergenic
990449235 5:55919420-55919442 GCTTTGATGATGAAGGAGCAGGG - Intronic
994199694 5:96958746-96958768 GCTTTGAAGATGAAGGAGCAGGG - Intronic
999146585 5:149399969-149399991 GCTACTGTGAAGAAGCAGGAAGG - Intronic
1003495292 6:6658372-6658394 GCTCTGATGATGTAGGAGGATGG - Intergenic
1004518066 6:16337371-16337393 GCCTGGATGAGGAAGGAGGAGGG + Intronic
1011559206 6:88598133-88598155 GCTCCGCTGAGGATGGAGGAAGG + Intergenic
1011913138 6:92467129-92467151 GCTGTCATGATGAAGGAAGAAGG - Intergenic
1013604159 6:111732562-111732584 GCTATTATGATGGAGGAGGGTGG - Intronic
1017441604 6:154469332-154469354 GCGATGATGATGGGGGAGGAGGG - Intronic
1020383385 7:7569857-7569879 GGTATGGTGATGAGGGAGGAGGG + Intronic
1022349251 7:29551555-29551577 GAGAAGAGGATGAAGGAGGAGGG + Intergenic
1023876026 7:44286816-44286838 GCGCCGCTGAGGAAGGAGGAAGG + Intronic
1023910663 7:44553352-44553374 GCGAGGAGGAAGAAGGAGGAGGG + Intergenic
1025175901 7:56802349-56802371 GCCACGGTGAGGAAGGAGGTGGG + Intergenic
1025695892 7:63774073-63774095 GCCACGGTGAGGAAGGAGGTGGG - Intergenic
1027482638 7:78718052-78718074 GCTATGATGATAAATGAGCAAGG - Intronic
1029622599 7:101699305-101699327 GCTGCGCTGAGGCAGGAGGAGGG - Intergenic
1034951807 7:155303167-155303189 CTTCCGATGGTGAAGGAGGAGGG - Intronic
1035307528 7:157942854-157942876 GCTACGCAGATGAAGGTGGCTGG - Intronic
1037716460 8:21405361-21405383 GCTAGGAGGATGAAGGCAGATGG + Intergenic
1039578438 8:38644332-38644354 GCTACGATGGTGAAGGAAAGAGG - Intergenic
1039779729 8:40772598-40772620 AATAAGATGATGAAGGTGGAAGG - Intronic
1042852806 8:73233645-73233667 GCTTCGGTGATTAAGGATGAAGG - Intergenic
1045233441 8:100328207-100328229 ATTACGATGATTAAGGAGAATGG - Intronic
1046324275 8:112620326-112620348 ACTACAATGATGTAGGAGAATGG + Intronic
1047455935 8:125011604-125011626 TCTTCACTGATGAAGGAGGAAGG - Exonic
1049041047 8:140112039-140112061 GCCAAGTTGATGAAGGAGAAGGG - Intronic
1049533045 8:143165922-143165944 GCTTCCAGGATGAAGGAGGCTGG - Intergenic
1051675995 9:19558770-19558792 GCTCCAATAATGAAAGAGGAGGG - Intronic
1052167556 9:25351797-25351819 GCTACTAAGAGGAGGGAGGAAGG - Intergenic
1055398018 9:75893378-75893400 CATGCCATGATGAAGGAGGAAGG + Intronic
1057226662 9:93296458-93296480 GGAAGGATGAAGAAGGAGGAAGG - Intronic
1058847710 9:108978421-108978443 GTAAAGATGATGAAGGAGGGTGG - Intronic
1060175373 9:121493717-121493739 TCTAGGAAGCTGAAGGAGGATGG - Intergenic
1060337796 9:122742991-122743013 GCTAAAATGATGAAGGTGAAAGG + Intergenic
1061210099 9:129186512-129186534 GCTGCCATGAGGAAGGATGAAGG - Intergenic
1062112918 9:134791925-134791947 GCTGTGATGATGAAGGACAAGGG + Intronic
1185550680 X:980847-980869 GCTGGGATGATGGAGGAAGAGGG + Intergenic
1186016237 X:5197869-5197891 GCTACAATGAAGAGGGAGCATGG - Intergenic
1186727007 X:12367989-12368011 GCTAAGGTCATGCAGGAGGATGG - Intronic
1187648225 X:21373752-21373774 GCAGCGATGATGAGGCAGGAGGG - Intergenic
1188269379 X:28119966-28119988 TCTGGGATCATGAAGGAGGAAGG + Intergenic
1195519541 X:105815209-105815231 GCTAGAATGATGAATGAGCAGGG - Intergenic
1195605639 X:106802951-106802973 GCTACGGGGAGGAAGGCGGAGGG + Exonic
1200184092 X:154170469-154170491 GCTACAAAGGTGAAGGAGGAGGG + Intergenic
1200189746 X:154207597-154207619 GCTACAAAGGTGAAGGAGGAGGG + Intergenic
1200195499 X:154245406-154245428 GCTACAAAGGTGAAGGAGGAGGG + Intergenic
1200201151 X:154282527-154282549 GCTACAAAGGTGAAGGAGGAGGG + Intronic