ID: 1138932026

View in Genome Browser
Species Human (GRCh38)
Location 16:61670717-61670739
Sequence CCATGGTTTCATGTATCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 2, 1: 0, 2: 5, 3: 35, 4: 366}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138932026 Original CRISPR CCATGGTTTCATGTATCTCC TGG (reversed) Intronic
903078868 1:20792889-20792911 CCGTGGTTTCAGGCATCTACTGG - Intergenic
904270646 1:29347789-29347811 TTATGGCTTCATGTATCTCTGGG + Intergenic
904692768 1:32306781-32306803 CCATGGTTTCAGGAATCTACTGG - Intronic
906573535 1:46866235-46866257 CCATGGTTTCAGGCATCCACTGG - Intergenic
906598333 1:47100787-47100809 CCATGGTTTCAGGCATCCACTGG + Intronic
906757933 1:48338542-48338564 CCAGATTTTCAAGTATCTCCAGG - Intronic
908205603 1:61845077-61845099 CTGTGGTTTCAGGTATCTGCTGG + Intronic
908518633 1:64918773-64918795 ACATGATTTCATGTATCTAAAGG - Intronic
909029154 1:70518615-70518637 CCATTTTTTCATATATCTGCTGG - Intergenic
909450623 1:75794287-75794309 TCATGGTTCCATGGATTTCCAGG + Intronic
909791498 1:79684632-79684654 CCATGGTTTCAGGCATCCACTGG - Intergenic
910958066 1:92729328-92729350 CCACAGTTTCAGGTATCTCCTGG + Intronic
911410898 1:97504982-97505004 CCATTGATTAATGTAGCTCCAGG + Intronic
912081603 1:105944069-105944091 GCATTGTTTCATGTGTCTCTTGG + Intergenic
912162947 1:107008513-107008535 TCATGGTTTCAGGTATCCCCTGG + Intergenic
917276161 1:173333938-173333960 CCAGGGTTTCAGGGTTCTCCAGG + Intergenic
917802525 1:178583289-178583311 CCAAGGTTTCAGGCATCTACTGG - Intergenic
918019336 1:180669709-180669731 CCATGGTTTCAAGTATCCACTGG - Intronic
919110351 1:193211165-193211187 CCCTGGTTTCAGGTATCCGCTGG - Intronic
919805083 1:201376736-201376758 CCTTGGTTTCTAGTTTCTCCTGG - Intronic
920000447 1:202794769-202794791 CCATGGTTTCAGGCATCCACTGG - Intronic
921625963 1:217378237-217378259 AATTGGTTTCATGTTTCTCCTGG - Intergenic
921960186 1:221026168-221026190 CCTTGGTTTCAGGTACCTACTGG + Intergenic
922087517 1:222365022-222365044 CCATTGTTTGATGGAGCTCCTGG - Intergenic
922751660 1:228073015-228073037 CCAAGGGTTCATCTCTCTCCTGG + Intergenic
923541718 1:234893027-234893049 CGCTGGTTTCAGGCATCTCCTGG - Intergenic
923905192 1:238376721-238376743 CAATGGTTTCGTGTATCTCCAGG + Intergenic
924499950 1:244628238-244628260 CCATGGTTTCAGGCATCTAGTGG + Intronic
1064265877 10:13825032-13825054 CCATGGTTTCAGGTATCTACTGG - Intronic
1064416493 10:15154487-15154509 CCATGGTTTTAGGCATCTCCTGG - Intronic
1064775169 10:18768827-18768849 ACATGTTTTCATGTACTTCCTGG + Intergenic
1066024081 10:31335344-31335366 CCATGGTTTCAGGCATCCTCAGG + Intronic
1067274895 10:44825299-44825321 CCAAGGTTTCAGGCATCTGCTGG - Intergenic
1068817727 10:61336494-61336516 CCATGGTTTCAGGCATCCACTGG + Intergenic
1070432220 10:76352186-76352208 CCATGGTTTCAGGCATCCACTGG - Intronic
1070762584 10:79034001-79034023 CCATGGTTTCAGGCATCCACTGG + Intergenic
1071201800 10:83227922-83227944 CCATGGTTTCAGGCATCCACTGG + Intergenic
1072267347 10:93743586-93743608 CCATGGTTTCAGGCATCCACCGG + Intergenic
1074129669 10:110562835-110562857 CCAGGACTTCATGTATCACCTGG - Intergenic
1074850383 10:117434685-117434707 CCATGGTTTCTTCATTCTCCAGG - Intergenic
1078055717 11:8007379-8007401 CCATGGCTTCAGGTATCCACTGG - Intergenic
1078438753 11:11346825-11346847 CCATGCTTTCTTGTATTTCTGGG - Intronic
1078554150 11:12305073-12305095 CCATGGTTTCAGGTATCCACTGG - Intronic
1080141017 11:28920215-28920237 CCATGGTTTCAGGCATCCACTGG + Intergenic
1080145505 11:28978163-28978185 GCATTTTTTCATGTGTCTCCTGG + Intergenic
1081387422 11:42488018-42488040 CCATGGTTTTAGGCATCTGCTGG - Intergenic
1081455591 11:43219370-43219392 CTATGGTTTCAGGCATCTACTGG - Intergenic
1082733231 11:56825632-56825654 TCATGGTTTCATGGTTCTGCAGG + Intergenic
1084433132 11:69122594-69122616 ACAAGGTTTCATTTATATCCAGG + Intergenic
1085696316 11:78707775-78707797 GCATTGTTTCATGTATCTTCAGG + Intronic
1085886512 11:80528969-80528991 CCATGGTTTCAAGCATCCACTGG - Intergenic
1086963178 11:93001027-93001049 CCTTGGTTTCAGCTATCTCCTGG + Intergenic
1087062787 11:93998132-93998154 CCATGTTTTCATGTATCAAAAGG + Intergenic
1087490894 11:98825952-98825974 CCAGGATTTCAGGTATCACCTGG - Intergenic
1087549593 11:99632062-99632084 CCATGGTTTCAGGTATCCCCTGG + Intronic
1087783693 11:102329983-102330005 TCCTGGTCTCATGTATCTACTGG + Intronic
1088086968 11:105993055-105993077 CCTTGGTTAAATGTATTTCCAGG + Intergenic
1088777383 11:113098911-113098933 CAATGGTTTTAATTATCTCCAGG - Intronic
1088876157 11:113938201-113938223 CCAAGAATTCATGTATTTCCTGG - Intronic
1089049559 11:115534408-115534430 CCATGCTTTCTTTTAGCTCCAGG + Intergenic
1089147035 11:116336616-116336638 CCATGGAGCCATTTATCTCCTGG + Intergenic
1089375616 11:117992456-117992478 CCATTTTTTCATGTATCTGTTGG + Intronic
1091756468 12:3055710-3055732 GCGTGCTTTCATGTGTCTCCAGG - Intergenic
1092042465 12:5396571-5396593 CTATGGTTTCATGCACCTTCTGG - Intergenic
1093123729 12:15303576-15303598 ACATGTTTTCATGTATGTACGGG + Intronic
1093425615 12:19025532-19025554 CCATGGTTTCAGACATCTACTGG + Intergenic
1093579943 12:20775365-20775387 CCATGGTTACATTTATTTCTAGG - Intergenic
1093609731 12:21138837-21138859 CTGTGGTTTCATGTGTCTGCAGG + Intronic
1093843313 12:23933341-23933363 CCATGGTTTCAGGCATCCACTGG + Intronic
1093917851 12:24825562-24825584 GCATTTTTTCATGTACCTCCTGG + Intronic
1095994866 12:48072850-48072872 CCATGGTTTCAAGCATCCACTGG + Intronic
1097539491 12:60920530-60920552 CCATGGTTTCAGGCATCCACTGG - Intergenic
1099337690 12:81385086-81385108 GCATTTTTTCATGTATCTGCTGG - Intronic
1100024082 12:90106282-90106304 CCATGGTTTCAGGCATCCACTGG - Intergenic
1101499490 12:105289126-105289148 CCATGTTTACATGTGCCTCCTGG + Intronic
1102761797 12:115393700-115393722 GCATCTTTTCATGTATCTCTGGG - Intergenic
1103227396 12:119299813-119299835 CCATGGTTTCAGGCATCTACTGG - Intergenic
1104527542 12:129538506-129538528 CCATGGTTTCATACATCCACTGG - Intronic
1104800091 12:131548494-131548516 CCATGGTTTCAGGCATCCACTGG - Intergenic
1106131707 13:26945961-26945983 GCATGTTTTCATGTATTTGCTGG - Intergenic
1106906533 13:34415408-34415430 CTCTGGTTTCTTCTATCTCCTGG - Intergenic
1107700472 13:43042096-43042118 CCATGGTTTCAGGCATCCACTGG - Intronic
1107731017 13:43348983-43349005 CCATGGTTTCAGGCATCCACTGG + Intronic
1108094357 13:46885006-46885028 CCTTGGTTTCAGGCATCTACTGG - Intronic
1108465395 13:50709908-50709930 CCATGGTTTCAGGCATCCACTGG - Intronic
1109282990 13:60378782-60378804 CAGTGGTTTCTTGTATCTCCAGG + Intergenic
1109309794 13:60678976-60678998 CCATGGTTTCAGGCATCCACTGG - Intergenic
1109643455 13:65222013-65222035 CCATTTTTTCATGTGTCTCTTGG - Intergenic
1110017849 13:70431288-70431310 CCATGGTTTCAGGCATCCACTGG - Intergenic
1111058410 13:82980314-82980336 CCATGGTTAAATGTAGCTCCAGG - Intergenic
1111560190 13:89934585-89934607 CCATGGTTTCATGTATCTCCTGG + Intergenic
1112072871 13:95874254-95874276 CCATGGTTTCATACATCCACTGG - Intronic
1112633438 13:101187319-101187341 CCATGGTTTCAGGTATCTACTGG + Intronic
1113887081 13:113666591-113666613 CCTTGGTTTGATGTAGCTCCGGG + Intergenic
1114343874 14:21774872-21774894 CTATTGTTGCAGGTATCTCCAGG - Intergenic
1114881078 14:26787070-26787092 CCATAGTTAGATATATCTCCAGG + Intergenic
1114942029 14:27624335-27624357 TCAAAGTTTCATGGATCTCCAGG + Intergenic
1115345101 14:32334640-32334662 CCATGGTTTCAGGCATCCACTGG + Intronic
1115351317 14:32398583-32398605 CCATGGTTCCAGGCTTCTCCTGG + Intronic
1116081756 14:40183173-40183195 ACATTTTTGCATGTATCTCCTGG - Intergenic
1116432545 14:44863709-44863731 CCAGGGTTTCATGTATCAGCTGG + Intergenic
1117601705 14:57382574-57382596 CCATGGTTTCAGGCATCCCCTGG + Intergenic
1118411023 14:65478253-65478275 CCATGGTTTCAGGTATCCACTGG - Intronic
1120099272 14:80425476-80425498 CCATGGTTTCAGGCATCCACTGG - Intergenic
1120122074 14:80693297-80693319 CCATAATTTCATGTATCTCCTGG + Intronic
1123573582 15:21642265-21642287 CCATGGTTTCAGGCATCCACAGG - Intergenic
1123610202 15:22084851-22084873 CCATGGTTTCAGGCATCCACAGG - Intergenic
1123797306 15:23784561-23784583 GCTTTGTTTCATGTATCTTCTGG + Intergenic
1123928303 15:25140873-25140895 GCTTGGTCTCAGGTATCTCCAGG - Intergenic
1124417551 15:29485738-29485760 GCATTCTTTCATATATCTCCTGG - Intronic
1126009581 15:44289385-44289407 CCATGGTTTCTTTTCTCCCCGGG + Intronic
1128589411 15:68881650-68881672 CCATGGTTTCAGGCATGTACTGG + Intronic
1128821583 15:70660985-70661007 CCATGGTTTCAGGCATCCACTGG + Intronic
1129755127 15:78093409-78093431 CCATGTTTTCATTTAGCACCTGG + Intronic
1131151506 15:90050119-90050141 TAATGCCTTCATGTATCTCCTGG - Intronic
1131321025 15:91391257-91391279 CCATGGTTTCACTTACTTCCAGG + Intergenic
1131933740 15:97477500-97477522 CCATGGTTTCAGGCATTTACTGG - Intergenic
1202982450 15_KI270727v1_random:376616-376638 CCATGGTTTCAGGCATCCACAGG - Intergenic
1132686849 16:1165807-1165829 CCATGGTTTCCTTTCTCCCCAGG + Intronic
1135487003 16:22874507-22874529 CCATGCTTCCATGTGTGTCCTGG + Intronic
1137044789 16:35644783-35644805 GCAGGGTTTCATGTTTCTTCTGG - Intergenic
1137451793 16:48582730-48582752 CCAAGGTTTTAGGTATCTACTGG + Intronic
1137636541 16:49991812-49991834 CCATGGTTTGAAGTATCCACTGG - Intergenic
1137735101 16:50717905-50717927 CCATGGTTTCAGGCATCCACTGG - Intronic
1137741036 16:50774351-50774373 CCATAGTTTCAGGTATCCACTGG - Intronic
1137909786 16:52365294-52365316 CCAGGCTTTCATGTATCTCTAGG + Intergenic
1138126767 16:54445547-54445569 CCATGGTTTCAGGCATCCACTGG + Intergenic
1138932026 16:61670717-61670739 CCATGGTTTCATGTATCTCCTGG - Intronic
1139208719 16:65055093-65055115 CCATGACTCCCTGTATCTCCAGG - Intronic
1139622980 16:68162419-68162441 CCATGGTCTTATCTATCACCTGG - Intronic
1140555056 16:75912398-75912420 CCAGGGTTTCAGGCATCTACTGG + Intergenic
1141246326 16:82311202-82311224 CCATGGTTTCAGGCATCCACTGG + Intergenic
1141362734 16:83411424-83411446 CCATGCTTTCATGGAGCTCTTGG - Intronic
1143856488 17:9854682-9854704 CCCTGGTTTCAGGCATCTACTGG - Intronic
1144498467 17:15765235-15765257 CCATGATTTCAGGCAGCTCCTGG - Intergenic
1145161849 17:20580276-20580298 CCATGATTTCAGGCAGCTCCTGG - Exonic
1146129725 17:30260967-30260989 AGAGGGTTTCATGTCTCTCCAGG - Intronic
1146674979 17:34767206-34767228 CTGTGGTTTCAGGTATCTCTGGG - Intergenic
1146808754 17:35886896-35886918 CCATGGTTTCAGGCATCCACTGG + Intergenic
1148895744 17:50838053-50838075 CCAGGCTTTCATGGACCTCCAGG + Intronic
1149346609 17:55743499-55743521 CCGTGGTTTCAGGTACCCCCTGG + Intergenic
1149447757 17:56726654-56726676 CCAAGGTTTCAGGTATCCACTGG - Intergenic
1149960702 17:61106603-61106625 CCATGGTTTCAGGCATCCACTGG + Intronic
1150174499 17:63036918-63036940 CCATAGTTTCAGGAATCTACTGG - Intronic
1150326008 17:64258335-64258357 CCATGGTTTCAGGCATCCACTGG + Intronic
1150575473 17:66426816-66426838 CCATGCGTGCATGTATCTCCTGG + Intronic
1153174645 18:2357315-2357337 CCATGGTTTCAGGCATCCACTGG + Intergenic
1153586916 18:6631301-6631323 AAATGGTTTCATTTTTCTCCTGG - Intergenic
1156312145 18:35934580-35934602 CCATGGTTTCAGGTATCCACTGG + Intergenic
1157044212 18:44078461-44078483 CCCTGGTTTCAGGCATCTACTGG - Intergenic
1157122945 18:44928690-44928712 GCATGTTTTCATGTGTCTGCTGG + Intronic
1157375765 18:47163046-47163068 CTATGGTTTCAGGCATCCCCTGG - Intronic
1158126800 18:54108824-54108846 CCATGGTTTCAGGCATCCACTGG - Intergenic
1158341953 18:56475842-56475864 CCATGGTTTCAGGCATCCACTGG + Intergenic
1163101257 19:15098332-15098354 CCACGGTTTCAGGAATCTACCGG + Intergenic
1164842847 19:31406413-31406435 CCATGGTGTCTTTTATCTTCAGG - Intergenic
1164967637 19:32499190-32499212 CCTGGGTTTCATGAAGCTCCTGG + Intergenic
1165285266 19:34836924-34836946 CCATGTTTTCATTTCTCTCAAGG + Intergenic
1165731534 19:38148790-38148812 CTATGGTTTCAGATGTCTCCAGG - Intronic
1166360409 19:42250793-42250815 CGACGGTTTCCTGTTTCTCCCGG - Intronic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1166730048 19:45054038-45054060 CCAAGTGTTCATGTATGTCCAGG + Intronic
1166916633 19:46199748-46199770 CCATGGTTCCAGGCATTTCCTGG - Intergenic
1168683014 19:58329808-58329830 CCATGGTTTCAGGCATCCACTGG + Intronic
926262137 2:11274843-11274865 CCATGGTTTCAGGTAACCACTGG - Intronic
927174676 2:20397366-20397388 CCATGGTTTCAGGCATCCACTGG - Intergenic
929633434 2:43490829-43490851 CCATGGTTTCAGGCATCCACTGG + Intronic
930267534 2:49217465-49217487 CCATGGTTTCAGGCATCCACTGG - Intergenic
930530146 2:52579859-52579881 CCATGGCTGAATGTATCTCCAGG - Intergenic
930647609 2:53928699-53928721 CCATGGTTTCAGGTATGCACTGG + Intronic
930946331 2:57081129-57081151 CCATGGTTTAAGGCATCCCCTGG - Intergenic
931240544 2:60448507-60448529 CCATGACTTAATGTAACTCCAGG + Intergenic
931693879 2:64858089-64858111 GCCTGGTTTCAAGTATTTCCCGG + Intergenic
932078898 2:68693173-68693195 TCAAGTTTACATGTATCTCCAGG + Intronic
932107483 2:68959172-68959194 ACATGGCTTCATGTTTTTCCTGG + Intergenic
932695225 2:73950699-73950721 ACATGGCTTCATCTACCTCCAGG + Exonic
932849898 2:75174313-75174335 CCATGGTTTCAGGCATCTGCTGG - Intronic
933082516 2:78009924-78009946 CCATGGTCTCAGGCATCTACTGG + Intergenic
933222357 2:79705486-79705508 CCATGGTTTCAGGTGTCCACTGG + Intronic
934499057 2:94839707-94839729 TCATGGTTTCATGCATCCACTGG + Intergenic
936910532 2:117587280-117587302 GTATGTTTTCATGTACCTCCTGG - Intergenic
939161024 2:138589072-138589094 CTATGGTTTCAAGCATCTACTGG - Intergenic
940016128 2:149106953-149106975 CCATGGTTTCAAGAATCCACTGG - Intronic
940261315 2:151782518-151782540 CCATGGTTTCAGGTGTCCACTGG + Intergenic
940705294 2:157098015-157098037 GCATTTTTTCATGTATCTGCTGG + Intergenic
940755007 2:157671907-157671929 CCATGGTTTCAGGCATCCACTGG - Intergenic
942011221 2:171764266-171764288 TCATGGTTTCAGGTATCCACTGG + Intergenic
942436695 2:175985632-175985654 CCATGGTTTCAGGCATCCACTGG - Intronic
942658396 2:178238765-178238787 CCATGGTTTCAGGTACCCACTGG + Intronic
943784905 2:191866723-191866745 CCATGGGTTCATTTAACTCGAGG + Intergenic
945383969 2:209174690-209174712 CCATGGTTTCAGGCATCCACTGG + Intergenic
947448582 2:230183959-230183981 CCATGGTTTCAGGCATCCACTGG - Intronic
947801289 2:232929644-232929666 CCATGGACCCAGGTATCTCCAGG + Intronic
949022080 2:241747129-241747151 ACAGGGTCTCATGTAACTCCTGG + Intronic
1169187187 20:3628649-3628671 CCATGGTTTCACGCATCCACTGG + Intronic
1169271462 20:4202604-4202626 CCAGTGAATCATGTATCTCCGGG + Intergenic
1169670122 20:8090096-8090118 CCTTGGTTTCATGTCTCTCTGGG + Intergenic
1171263632 20:23752956-23752978 CCAGGGTTTCCTGTAGCTTCTGG - Intergenic
1171512611 20:25697350-25697372 CAATGGTTTAATTTTTCTCCAGG + Intergenic
1171890296 20:30706428-30706450 TCATGGTTTCATGCATCCACTGG + Intergenic
1171986081 20:31662121-31662143 CCATGGTTTCATGAATGCTCCGG - Intergenic
1172251151 20:33480172-33480194 ACATGGTTTCATGAATGCCCTGG - Intergenic
1172264901 20:33602600-33602622 CCATGGTTTCAGGCATCCACCGG - Intronic
1173012330 20:39193334-39193356 CCATGGTTTCAGGCATCCACTGG - Intergenic
1174876145 20:54228242-54228264 CCATGGTTTCAAGCATGGCCTGG - Intergenic
1175040277 20:56043014-56043036 CCATGGTTTCAGGTGTCTACTGG - Intergenic
1175180364 20:57142477-57142499 CCAGGGTTTCCTGTCTCCCCTGG + Intergenic
1177552682 21:22646242-22646264 CCATGGTTTCAGGCATCCACTGG + Intergenic
1179232099 21:39513566-39513588 CCACGATTTGATGTCTCTCCAGG + Intronic
1179234927 21:39537323-39537345 CCAAGGTTTCAAGTATCCACTGG + Intergenic
1179570355 21:42274976-42274998 CCCAGGCTTCATGTCTCTCCTGG + Intronic
949661819 3:6288046-6288068 CCATGGTTACATGTATTTCTTGG - Intergenic
950285492 3:11741498-11741520 CCATGGTTTCAGGCATCCTCTGG - Intergenic
953143390 3:40249948-40249970 CCAGGCTTTCATTTATCCCCAGG + Intronic
953273791 3:41474728-41474750 GCATCTTTTCATGTATCTCGTGG - Intronic
953528008 3:43711330-43711352 CAATGGTTCCATGTATGTCTAGG - Intronic
956036706 3:65101027-65101049 CCATGCTTTCATGTCTCTTGTGG + Intergenic
957471553 3:80665032-80665054 CCATGGTTGGATGCATCTGCAGG + Intergenic
957545956 3:81636993-81637015 CCATGGTTTCAGGCATCCACTGG - Intronic
957796385 3:85014508-85014530 TCTTGGTTTCAGGCATCTCCTGG + Intronic
960436956 3:117638049-117638071 CCATGGTTTCAGGCATCCACTGG + Intergenic
960679293 3:120230409-120230431 CCATGGTTTCAGGCATCCACTGG - Intronic
961215248 3:125154606-125154628 CCTTGGTTTCAGGCATCCCCTGG - Intronic
961351190 3:126305187-126305209 CCATGTTTTCATCTATGGCCTGG + Intergenic
961917104 3:130388167-130388189 CCAGGGTTTTATGTATATTCTGG - Intronic
962256862 3:133877048-133877070 CCTCTGTTTCATGTATCTCAGGG - Intronic
962372058 3:134828871-134828893 CCAAGATTTCCTGTATCTGCAGG + Intronic
964046238 3:152330867-152330889 CCATGGTTTCAGGCATCCTCTGG + Intronic
965239366 3:166174848-166174870 TCCTGGTGTCATGTATCACCCGG - Intergenic
966457356 3:180132994-180133016 TCATGGTTTGAGGTATCACCTGG + Intergenic
966682699 3:182660158-182660180 CCATGGTATTATGTTTCTCTGGG + Intergenic
967431356 3:189389703-189389725 CCATGGTTTCAAGCATCCACTGG + Intergenic
968984404 4:3867303-3867325 CCCTCATTTCATGTCTCTCCTGG - Intergenic
969216798 4:5729580-5729602 CCATGGTTCCTTGTATCCCCAGG + Intronic
970555346 4:17225908-17225930 CCCTGGCTTCATGTCACTCCTGG + Intergenic
971196419 4:24474713-24474735 CTATTGTTTCCTGTGTCTCCTGG + Intergenic
971469996 4:27013425-27013447 CCATGGTTTCAGGCATCCACTGG + Intronic
973214380 4:47653268-47653290 CTATGGTTTCAGGTATCCACTGG + Intronic
973244739 4:47999274-47999296 CCATGGTTTCAGGCACCCCCTGG + Intronic
974111236 4:57528154-57528176 GCATCTTTTCATGTACCTCCTGG - Intergenic
974727983 4:65821166-65821188 GCATGTTTTCATATACCTCCTGG - Intergenic
974900106 4:67986446-67986468 CTATGATTTCATGTTTCTCCAGG + Intergenic
975520207 4:75292418-75292440 GCATTTTTTCATGTATCTGCTGG + Intergenic
975869558 4:78764745-78764767 CCTTGGTTTCAGGTATCCTCTGG - Intergenic
976567092 4:86563616-86563638 CCGTGGTTTCAGGCATCTACTGG - Intronic
976770341 4:88645549-88645571 CCAAGGTTTCAGGTATCTAGTGG - Intronic
977496879 4:97786976-97786998 CCATGGTTTCAGGCATCCACTGG + Intronic
978637574 4:110828038-110828060 GCATGGTTTCATGTGTCTGTTGG + Intergenic
979011397 4:115375111-115375133 TCATGGTTTCAGGCATCCCCTGG + Intergenic
979400864 4:120247650-120247672 CCATGTTTCCATGGATCTCAGGG + Intergenic
981388580 4:144160512-144160534 CCATGGTTACCTGTATTTCTAGG + Intergenic
981788927 4:148513442-148513464 CCATGGTTTCAGGCATCCCCTGG + Intergenic
982645929 4:158025898-158025920 CCCTGGCTTCATGTGGCTCCTGG - Intergenic
982849859 4:160299134-160299156 CCCTGGATTCATGAAGCTCCAGG - Intergenic
983378114 4:166956177-166956199 TCATGGTTTCAGGCATCTACTGG - Intronic
983631181 4:169851141-169851163 CCACGGTTTCATTTTTCTCTCGG - Intergenic
983787568 4:171753102-171753124 ACATGTTTTCATGTACCTACTGG - Intergenic
984933496 4:184868985-184869007 CCATGGTTTCAGGCATCCACGGG - Intergenic
985410822 4:189681850-189681872 TCATGGTATCATCTATCTCTGGG + Intergenic
1202770552 4_GL000008v2_random:202134-202156 CCATGGTTTCATGCATGCACTGG + Intergenic
985913692 5:2902076-2902098 CCATTGTTTCACATATCTCTGGG + Intergenic
987754378 5:22081993-22082015 CCTTGGTTTCAGGCATTTCCTGG - Intronic
988691534 5:33577315-33577337 CCATGGAAATATGTATCTCCTGG + Intronic
988823365 5:34910214-34910236 CCATGGTATCTTTCATCTCCAGG - Intronic
988921336 5:35945626-35945648 CCTTGGTTTCATCCAGCTCCAGG + Intergenic
988944719 5:36185023-36185045 CCATTTTTTCATGTGTCTCTTGG + Intergenic
989024632 5:37053044-37053066 CCATGGTTTCATGCATCCACTGG - Intronic
989491847 5:42065270-42065292 CTATGGTTTCAGGCATCTACTGG + Intergenic
990542809 5:56791298-56791320 CCATGGTTTCAGGCATTTACTGG - Intergenic
990569879 5:57067579-57067601 CCATGGTTTCAGGCATCCACTGG + Intergenic
990720114 5:58685175-58685197 CCATGGTTTCAGGCATCCACTGG + Intronic
992053631 5:72965064-72965086 CCATGGTTTCAGGCATCCACTGG + Intronic
992707148 5:79408140-79408162 CCATGGTTTCAGGCATCCACTGG + Intronic
992925236 5:81577352-81577374 ACACTGTTTCATATATCTCCAGG - Intronic
993092245 5:83440822-83440844 CCACGGTTTCAGGCATCTACCGG - Intergenic
993136306 5:83969651-83969673 ACATTGTTTCATTTATCTTCAGG + Intronic
993239912 5:85368995-85369017 CCATGGTTGCTAGCATCTCCAGG + Intergenic
994030231 5:95133236-95133258 CCATGGTTTCAAGTATCCAGTGG - Intronic
994365406 5:98910814-98910836 CCATCGTTTCATGTGCCTCAAGG + Intronic
994410519 5:99402274-99402296 CCATGGTTTCAGGCATCCACTGG - Intergenic
994483306 5:100362995-100363017 CCATGGTTTCAGGCATCCACTGG + Intergenic
994798907 5:104344637-104344659 CCATGGTTTCAGGTATCCAATGG - Intergenic
995370689 5:111415604-111415626 CCATGGTTTCAGGCATCTACTGG + Intronic
995804147 5:116032706-116032728 CCATGGTTTCAGGCATCCACTGG + Intronic
996969525 5:129346936-129346958 TCATGTTTTCATGTATCTGTTGG + Intergenic
997514804 5:134479744-134479766 GCATGGTTTCAGGCATCTACTGG - Intergenic
998448204 5:142214551-142214573 CCATGGTTTCAGGTATCCACTGG - Intergenic
999870929 5:155750460-155750482 GCATCCTTTCATGCATCTCCAGG - Intergenic
999890112 5:155968653-155968675 CTATGGTTTCAGGCATCTACTGG + Intronic
999966170 5:156811836-156811858 GCATTTTTTCATGTGTCTCCTGG - Intergenic
1000552768 5:162687155-162687177 CCATGGTTTTAAGCTTCTCCTGG + Intergenic
1000663456 5:163965040-163965062 CCATTGTGTCATGTTTCTGCAGG - Intergenic
1000694794 5:164367403-164367425 CCAAGGTTTCAGGCATCCCCTGG - Intergenic
1001815062 5:174661619-174661641 CTTTGGTTTGATGTGTCTCCTGG - Intergenic
1001841886 5:174883615-174883637 GCATTTTTTCATGTATCTCTTGG + Intergenic
1002795747 6:469902-469924 CCATGGTTTCAGGTGTCCCTGGG - Intergenic
1002881978 6:1261300-1261322 CCATGGTTTCAGGCATCCACTGG + Intergenic
1003984728 6:11424546-11424568 CCCTGGTTTCCTGAGTCTCCAGG + Intergenic
1005683634 6:28231050-28231072 CCTTGGTTTCAGGCATCTACTGG - Intronic
1006271490 6:32969835-32969857 CCAAGGTTTCGGGTTTCTCCAGG + Intronic
1007565021 6:42843333-42843355 CCATGGTCTCTTTTCTCTCCAGG - Intronic
1007836470 6:44677725-44677747 CCATGTTTTCATGTAACTTGTGG + Intergenic
1009189856 6:60617255-60617277 CCATTGTTTCATGTGTCTTTTGG + Intergenic
1010688824 6:78883950-78883972 CTATGGTTTCAGGTATCTGCTGG + Intronic
1011902687 6:92319752-92319774 AGATGGCTTCTTGTATCTCCAGG + Intergenic
1012112723 6:95258030-95258052 CCATAGTTTCAAGCATCTACTGG + Intergenic
1013860405 6:114628767-114628789 GCATTGTTTCATGTGTCTCTTGG + Intergenic
1014607116 6:123490244-123490266 TCATTGTTTCAGGTATCTACTGG - Intronic
1015173544 6:130280937-130280959 CCATGGTTTCAGGCATCCACTGG - Intronic
1015303716 6:131682796-131682818 ACATGGTTTCATGTATTTATTGG + Intronic
1016615919 6:146048274-146048296 CCTTGGCTTCATGTTTCTCTAGG + Intronic
1017079172 6:150650958-150650980 CCATGGTTTCAGGCATCCACGGG - Intronic
1018014647 6:159701138-159701160 CCATGGTTTCTCAAATCTCCAGG - Intronic
1018817614 6:167346642-167346664 GCATTTTTTCATGTATCTCTCGG - Intronic
1019669529 7:2270001-2270023 CCAGGGTCTCAGGTATCTCTGGG - Intronic
1020875278 7:13685617-13685639 CCATGGTTTCAGGCATCCTCCGG + Intergenic
1021827292 7:24568054-24568076 CCATGGTTTCAGGTATTCACTGG - Intergenic
1021898886 7:25263544-25263566 TCATGCTCTCATGTTTCTCCAGG - Intergenic
1022399199 7:30020487-30020509 CCATGGTTTCAGGCATCTAATGG - Intronic
1022942271 7:35252433-35252455 CCTTGGTTTCAAGTAGCTACAGG + Intronic
1023096594 7:36667532-36667554 CCATGGTTTCAGGCATCCACTGG + Intronic
1023451367 7:40289309-40289331 CCATGGTTTCAAGCATCCACTGG - Intronic
1024593374 7:50910491-50910513 ACATGTTTTCATTTATCTCTTGG + Intergenic
1025094391 7:56086242-56086264 CCATGGTTTCAGGCATCCACTGG - Intronic
1025274091 7:57559239-57559261 CCTTGGTTAGATGTATTTCCAGG - Intergenic
1026811954 7:73474954-73474976 CCATCTTTTCATGTGTCTCCTGG - Intronic
1027823600 7:83080797-83080819 CCATGGTTTCAGGCATCCACTGG - Intronic
1031073197 7:117185537-117185559 CCATGGTTTCAGGCATCCACTGG - Intronic
1031921773 7:127607492-127607514 CTGTGGTTTCAGGTATCTGCTGG - Intergenic
1032436278 7:131903122-131903144 CCATGGTTTCAGGCATCCACTGG - Intergenic
1034847967 7:154464876-154464898 CCATGGTTTCAGGCATCCACTGG - Intronic
1035907797 8:3532319-3532341 CCAGGGTTTTAAGAATCTCCTGG + Intronic
1037004826 8:13765234-13765256 GCACGTTTTCATGTATCTACTGG - Intergenic
1037038483 8:14200065-14200087 CCATGGTTTCTGACATCTCCTGG + Intronic
1037242745 8:16795954-16795976 CCGTGGTTTCAGGTATCCACTGG - Intergenic
1038375256 8:27033932-27033954 CCATGGTTTCAGGTTTCACTGGG + Intergenic
1038775682 8:30528449-30528471 CCATGGTCACAGGTATGTCCCGG - Intronic
1039929038 8:41966440-41966462 CCACGGTTTCAGGCATCTACTGG + Intronic
1040416120 8:47197522-47197544 CCATGGTTTTCTGTTCCTCCAGG + Intergenic
1040518258 8:48152132-48152154 CCATGTTTTCAGGTATCCACTGG + Intergenic
1040777044 8:51057701-51057723 CCATGGTTTCCTGTAGAGCCCGG - Intergenic
1040950846 8:52938156-52938178 CCATGGTTTCAGGCATCCACTGG + Intergenic
1041603474 8:59751536-59751558 CCATGTTTTCATGTGTCTGTTGG - Intergenic
1041615192 8:59898871-59898893 CCTTGGGTTCATGTCACTCCTGG - Intergenic
1041856004 8:62455890-62455912 CTGTGGTTTCATGTATCCACTGG - Intronic
1042023755 8:64400616-64400638 GCATTTTTTCATGTATCTGCTGG + Intergenic
1042032024 8:64486784-64486806 CAATTGTTTAATGCATCTCCAGG - Intergenic
1042223717 8:66498543-66498565 CCATGGTTTCAGGCATCCGCTGG - Intronic
1042481900 8:69313752-69313774 CTGTGGTTTCAGGCATCTCCTGG + Intergenic
1042808324 8:72796137-72796159 CCATGATCTCTTGTATCACCAGG + Intronic
1043656269 8:82671719-82671741 CCTTGGTGTCATATATCTCAGGG - Intergenic
1044538460 8:93383805-93383827 TCATGGTAACATGTATCGCCAGG + Intergenic
1046293150 8:112188796-112188818 CCATGGTTTCTTCAATCTTCTGG - Intergenic
1047012760 8:120690266-120690288 CCATGGTTTCAGGCATCTATTGG + Intronic
1047048043 8:121076922-121076944 CAATAGTTACATGTAGCTCCTGG - Intergenic
1047109785 8:121776834-121776856 CTGTGGTTTCAGGTATCTTCTGG + Intergenic
1048217155 8:132506806-132506828 TCATGGTTTCATCTAGCTGCAGG - Intergenic
1048241528 8:132747114-132747136 CCATGCTTTCATTTCTCTCTAGG - Intronic
1049083919 8:140463255-140463277 CCATAGTGTCATGTCTCACCTGG + Intergenic
1050089836 9:2006529-2006551 TCATGGTTTCAGGTTTCACCAGG + Intergenic
1050416864 9:5427637-5427659 CCATGGTTTCAGGTATCCACTGG + Intronic
1050492159 9:6199399-6199421 CCATGGTTTCAGGCATCCACTGG - Intergenic
1051115048 9:13685079-13685101 CCATGGTTTCAGGCATCTGCTGG + Intergenic
1052963116 9:34317903-34317925 CCATGGTTTCAGGCATCCACCGG + Intronic
1053841096 9:42188897-42188919 CCATGAGGTCATGTAGCTCCTGG - Exonic
1054098153 9:60919663-60919685 CCATGAGGTCATGTAGCTCCTGG - Intergenic
1054119554 9:61195293-61195315 CCATGAGGTCATGTAGCTCCTGG - Exonic
1054588199 9:66987269-66987291 CCATGAGGTCATGTAGCTCCTGG + Intergenic
1054748924 9:68884697-68884719 CCATTTTTTAATGTATCTACTGG - Intronic
1056710480 9:88988901-88988923 CCATGGTGTCATTTAACTCATGG + Intergenic
1057473869 9:95382364-95382386 CCATGCTTTCAGGTAGCTCAAGG - Intergenic
1057913582 9:99038685-99038707 CCATGGATTCATGAATTTCTCGG + Exonic
1058899133 9:109426643-109426665 CCATGGTTCTGTGTGTCTCCTGG - Intronic
1060746528 9:126137438-126137460 ACATCTTTTCATGTATCTACTGG - Intergenic
1061956406 9:133963704-133963726 GCATGATTTTATGTATCGCCAGG + Intronic
1203559904 Un_KI270744v1:44209-44231 TCATGGTTTCATGCATCCACTGG + Intergenic
1203660764 Un_KI270753v1:40374-40396 TCATGGTATCATCTATCTCTGGG - Intergenic
1203671940 Un_KI270755v1:23586-23608 TCATGGTATCATCTATCTCTGGG - Intergenic
1188369089 X:29347118-29347140 CCATGGTTTCAGGCATCCACAGG - Intronic
1188432138 X:30116132-30116154 TCATGTTTTCATGATTCTCCAGG - Intergenic
1188478796 X:30615891-30615913 CCATGGTTTCAGGCATCCACTGG + Intergenic
1189121812 X:38403258-38403280 CCTTTGTTTATTGTATCTCCAGG + Intronic
1190135844 X:47797149-47797171 CCATGGTTTCAAGCATTTACTGG + Intergenic
1190963162 X:55272165-55272187 CCATTTTTTCATGTGTCTTCTGG - Intronic
1191031564 X:55979414-55979436 CCATGGTTTCAGGCATCCACTGG + Intergenic
1191642091 X:63436901-63436923 CCATGGTATCATGCACCACCTGG + Intergenic
1193457973 X:81754764-81754786 CCATGGTTCCATGCCGCTCCAGG - Intergenic
1193671142 X:84388311-84388333 ACATGGTTTTATGTATTTCTTGG + Intronic
1193758935 X:85441392-85441414 CCTTGGTTACATGTCACTCCAGG + Intergenic
1194494419 X:94594321-94594343 CCTTGGTTCCATGTCACTCCTGG - Intergenic
1194535226 X:95097655-95097677 CCATGGTTTCAGGTATTGACTGG - Intergenic
1194589540 X:95781964-95781986 CCAAGGTTTCAGGTATCCACCGG + Intergenic
1195682910 X:107562159-107562181 CCATGGTTTCTCATATCTCTGGG - Intronic
1195739952 X:108053939-108053961 CCATGGTTTCAGGCATCCACTGG + Intronic
1196577532 X:117337225-117337247 CCTTGGTTCCTTGTATATCCTGG + Intergenic
1196695629 X:118608269-118608291 CCAGGGTTTCATGTATCAGCTGG - Exonic
1197190263 X:123639465-123639487 CCTTGGTTAGATGTATCTCTTGG + Intronic
1197966831 X:132072580-132072602 CCCTGGGCTTATGTATCTCCAGG - Intergenic
1198016438 X:132616058-132616080 CCATGGTTTCATGCATCCACAGG + Intergenic
1198593219 X:138207807-138207829 CAATCGTTTCCTGTATCTCAAGG - Intergenic
1198834234 X:140784435-140784457 CCATGTCTTCCTATATCTCCAGG + Exonic
1198995645 X:142571144-142571166 CTCTGGTTTCATGTCGCTCCTGG - Intergenic
1200090285 X:153632818-153632840 TCATGGTTTCATGATGCTCCAGG - Intergenic
1200341196 X:155397935-155397957 GCATGTTTTCATGTATCTATTGG - Intergenic
1200853318 Y:7909462-7909484 CCTTGGCTTCATGTTTTTCCTGG - Intergenic
1202235022 Y:22702546-22702568 GCATTTTTTCATGTATCTGCTGG - Intergenic
1202308137 Y:23493622-23493644 GCATTTTTTCATGTATCTGCTGG + Intergenic
1202562664 Y:26176964-26176986 GCATTTTTTCATGTATCTGCTGG - Intergenic