ID: 1138938129

View in Genome Browser
Species Human (GRCh38)
Location 16:61755961-61755983
Sequence CAAGCACATACAACCACGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26609
Summary {0: 2, 1: 3, 2: 239, 3: 3480, 4: 22885}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138938123_1138938129 30 Left 1138938123 16:61755908-61755930 CCTCGCTGGTTCAAGCGATTCTT 0: 2
1: 158
2: 6233
3: 64980
4: 167117
Right 1138938129 16:61755961-61755983 CAAGCACATACAACCACGCCTGG 0: 2
1: 3
2: 239
3: 3480
4: 22885
1138938125_1138938129 4 Left 1138938125 16:61755934-61755956 CCTCAGCCTCCAGAGTAGCTGGG 0: 8482
1: 204029
2: 270755
3: 182470
4: 97733
Right 1138938129 16:61755961-61755983 CAAGCACATACAACCACGCCTGG 0: 2
1: 3
2: 239
3: 3480
4: 22885
1138938127_1138938129 -2 Left 1138938127 16:61755940-61755962 CCTCCAGAGTAGCTGGGATTACA 0: 4414
1: 109521
2: 249523
3: 225351
4: 156218
Right 1138938129 16:61755961-61755983 CAAGCACATACAACCACGCCTGG 0: 2
1: 3
2: 239
3: 3480
4: 22885
1138938128_1138938129 -5 Left 1138938128 16:61755943-61755965 CCAGAGTAGCTGGGATTACAAGC 0: 2475
1: 80392
2: 213548
3: 231438
4: 181390
Right 1138938129 16:61755961-61755983 CAAGCACATACAACCACGCCTGG 0: 2
1: 3
2: 239
3: 3480
4: 22885

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138938129 Original CRISPR CAAGCACATACAACCACGCC TGG Intronic
Too many off-targets to display for this crispr