ID: 1138938253

View in Genome Browser
Species Human (GRCh38)
Location 16:61757700-61757722
Sequence GCCTTTCCAAGGGAGAGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138938253_1138938262 25 Left 1138938253 16:61757700-61757722 CCCAAACTCTCCCTTGGAAAGGC 0: 1
1: 0
2: 0
3: 14
4: 179
Right 1138938262 16:61757748-61757770 GCCATATGATTGAGCCATGTTGG 0: 1
1: 0
2: 7
3: 60
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138938253 Original CRISPR GCCTTTCCAAGGGAGAGTTT GGG (reversed) Intronic
900608061 1:3532546-3532568 GCATTTCGGAGGGAGATTTTCGG - Intronic
904210289 1:28882749-28882771 GCCCTTCCAAGGGAGAGATCGGG - Intergenic
904480308 1:30789149-30789171 TCCTTTCCAAGGCAGCATTTTGG + Intergenic
906095806 1:43223170-43223192 GCCTTTCCAAGGACGAGGTGGGG - Intronic
906309108 1:44740289-44740311 GCATTTTCAGGGGAGAATTTTGG - Intronic
908256647 1:62308811-62308833 GCCTTTCTCTGGGAGGGTTTGGG - Intronic
910097520 1:83540398-83540420 GAATGTCCAGGGGAGAGTTTAGG - Intergenic
912747741 1:112259461-112259483 GCCTTTCCAAGGAGAACTTTGGG + Intergenic
914341549 1:146764346-146764368 GCCTTTGCAATGGAGGGGTTAGG + Intergenic
916194938 1:162213740-162213762 GTATTTCCAAGGGAGAGCTAGGG - Intronic
916904817 1:169271561-169271583 GACTCTGCAAGGGAGAGTTCAGG - Intronic
917299543 1:173559291-173559313 GCCTTTCCAAGACAGGGTCTGGG + Intronic
919039903 1:192372317-192372339 GCCTATCAAATGGATAGTTTTGG - Intergenic
919526406 1:198658006-198658028 ACCTTTCCAGGGGAGAGATGTGG + Intronic
919888135 1:201950002-201950024 GCCTTTCAAGGGAAGACTTTTGG - Intergenic
920076578 1:203341679-203341701 GGCTTTCCAGGGGTGAGGTTAGG + Exonic
920261906 1:204694003-204694025 GACATGCCAAGGGAGAGGTTCGG - Intergenic
920935458 1:210429726-210429748 ACCTTTACAAGGGAGAGATCTGG - Intronic
921464672 1:215473090-215473112 ACCTTTCCATGGAAGAATTTTGG - Intergenic
924146510 1:241081461-241081483 GCCTCTCCATGGCAGTGTTTGGG - Intronic
924506564 1:244691059-244691081 GCCTTTCCAAGGTAGTAGTTTGG + Intronic
1066611164 10:37249937-37249959 GAGATTCCAGGGGAGAGTTTAGG + Intronic
1066648304 10:37633267-37633289 GCATTACCAAGGGTGAGTCTGGG + Intergenic
1068156543 10:53206285-53206307 GACTTTCCTAGGCAGAGTTTAGG - Intergenic
1068647497 10:59484404-59484426 ATCTTTCCAAGGGGGACTTTTGG + Intergenic
1070122195 10:73588688-73588710 GCCATTCAAAGCCAGAGTTTTGG - Intronic
1070446445 10:76509268-76509290 TCCTTTCCAAGATAGAATTTAGG + Intronic
1070723853 10:78774817-78774839 ACCTTTCCCAGGCAGTGTTTGGG + Intergenic
1071888432 10:89976331-89976353 GCCTTTCCAAGGGATTTTTAAGG + Intergenic
1073331848 10:102675120-102675142 GCCTCTGTAAGGGAGAGCTTGGG + Exonic
1074008699 10:109455682-109455704 GCCCTTTCAAGGGAGGTTTTAGG - Intergenic
1074374292 10:112926608-112926630 CCATTTCCAAGGGAGAGAATGGG - Intergenic
1075127694 10:119713749-119713771 GAATTTCCAAGGTAGGGTTTAGG - Intergenic
1075327692 10:121547770-121547792 GCCTGACCAAGGCAGACTTTGGG - Intronic
1077248392 11:1549958-1549980 GCCTTTCAGGAGGAGAGTTTTGG - Intergenic
1077800737 11:5533446-5533468 GCCTTTCCAAAGGAGCATCTTGG - Intronic
1078925621 11:15872234-15872256 GCCTTTGCAAGAAAGAGTCTTGG - Intergenic
1082082966 11:48026397-48026419 GCCTTTCCAAGTCAGAGATAGGG - Intronic
1084088766 11:66866706-66866728 GCTTTACCAAGGGGGAGTTTAGG - Intronic
1084907310 11:72358033-72358055 GCCTCTCCTTGGGAGAGTGTGGG - Intronic
1086569382 11:88264436-88264458 GCCTCTCCAAGGGATAGGTAAGG + Intergenic
1087193990 11:95286204-95286226 CCTTTTCCCAAGGAGAGTTTGGG - Intergenic
1089455942 11:118625854-118625876 GCCTTTGCAAGACTGAGTTTGGG - Intronic
1089768955 11:120788891-120788913 GCCCTTCCAGGGGAGAGGTTAGG - Intronic
1090165429 11:124541946-124541968 GCTTTTTCAAGGGTTAGTTTGGG - Intergenic
1094361335 12:29634484-29634506 GCCTTTCAAAGGGAGGGTGAGGG - Intronic
1098657102 12:73045942-73045964 ACCTTCCCATGGAAGAGTTTGGG + Intergenic
1103278011 12:119730327-119730349 GCCTTACCATGGGACATTTTTGG - Intronic
1104568883 12:129908110-129908132 CCCTTTCAGGGGGAGAGTTTGGG + Intergenic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1108434493 13:50388289-50388311 GCCTTTACAAGGGAGAACTCTGG + Intronic
1109842133 13:67932690-67932712 TTCTTTCCAAGGGTGAGTTTGGG - Intergenic
1115058218 14:29156769-29156791 GCCTTCTCAAGCTAGAGTTTGGG + Intergenic
1117736943 14:58777327-58777349 GCTTTTTCAAGGGAGAGGGTAGG - Intergenic
1119609547 14:76050120-76050142 GCCTTGCCAATGGAGAGATGAGG - Intronic
1121853690 14:97246925-97246947 CCCTTTCCTATGGAGATTTTGGG + Intergenic
1125179795 15:36869742-36869764 ACCTTGCCAAGGGAGATTTGTGG - Intergenic
1127289265 15:57555541-57555563 GCATTTCCAATGGAGGGATTTGG + Intergenic
1127291558 15:57575709-57575731 TCCTTGGCAATGGAGAGTTTGGG + Intergenic
1127732723 15:61815454-61815476 CCCTTTCTTAGGGAGGGTTTTGG - Intergenic
1128572470 15:68744600-68744622 GCCTTTTAATTGGAGAGTTTGGG - Intergenic
1132674058 16:1114452-1114474 GTCTTCCACAGGGAGAGTTTGGG - Intergenic
1135220167 16:20607551-20607573 CTCTTTCCAAGGGAGAGGATTGG - Intergenic
1135323445 16:21511875-21511897 GCCTTCCAGAGGGAGAGTTCAGG + Intergenic
1136334930 16:29605140-29605162 GCCTTCCAGAGGGAGAGTTCAGG + Intergenic
1137017372 16:35391463-35391485 CCCTTTCCCTGGGAGAGTTGGGG - Intergenic
1138938253 16:61757700-61757722 GCCTTTCCAAGGGAGAGTTTGGG - Intronic
1139992730 16:70953096-70953118 GCCTTTGCAATGGAGGGGTTAGG - Intronic
1140488716 16:75316226-75316248 ACCTTTACAAGTGAGAGTTCTGG - Intronic
1140885424 16:79238558-79238580 GGCATTCCCAGGGAGACTTTAGG - Intergenic
1141377077 16:83541227-83541249 ACCTTTCTAAGGAAGAGTGTTGG - Intronic
1141723109 16:85767802-85767824 GACTTTCGAAGGCAGAGTCTGGG + Intergenic
1143345329 17:6244932-6244954 GCCTCTCCCAGTGAGTGTTTTGG - Intergenic
1143967267 17:10765068-10765090 ACCTTTGCAAAGGAGAGTTTGGG - Intergenic
1152151996 17:78607446-78607468 GCATTTGCAGGGGAGAGCTTGGG - Intergenic
1153486886 18:5607880-5607902 GCCCTTCAAAGGTAGAATTTTGG - Intronic
1158036981 18:53043627-53043649 TCTTTGCCAAAGGAGAGTTTTGG + Intronic
1158932589 18:62335755-62335777 GTCTTTCCAAGGGCGTGCTTGGG + Intronic
1159118016 18:64137106-64137128 GTCTTTCTAAGGGAGAGGATAGG + Intergenic
1159450296 18:68592837-68592859 ACCTTTACAAGGGAGAGATGTGG + Intergenic
1160721994 19:601868-601890 GAGCTTCCCAGGGAGAGTTTTGG + Intronic
1162923059 19:13914877-13914899 TCCTTTCCTAGGGGGAGGTTAGG - Intronic
1163905199 19:20146315-20146337 TTCTTTCCAAGAGTGAGTTTAGG - Intergenic
1164048758 19:21565983-21566005 TTCTTTCCCAGAGAGAGTTTAGG - Intergenic
1164726226 19:30467753-30467775 GCATTTCTGAGGGAGGGTTTTGG + Intronic
1166166730 19:40995319-40995341 TCCTTTCCAATGGAGAGATGTGG + Intronic
1166435994 19:42766868-42766890 GCCTTCCCAAGGGACAGCTGGGG + Intronic
1166760345 19:45220575-45220597 GCCTTTCGAAGTGTGTGTTTTGG + Intronic
924974598 2:161068-161090 GCATTTCCTAGGAAGTGTTTAGG - Intergenic
926792689 2:16590997-16591019 GCCTTTCCAAGTGAAACTCTGGG - Intronic
927074449 2:19563946-19563968 TCCTTTCCAAGGTTAAGTTTAGG + Intergenic
928303779 2:30148179-30148201 TCCCTTTCAAGGGAGAGTCTGGG + Intronic
929091155 2:38218507-38218529 GCCTTTCCCAGGGAGCGCTGAGG + Intergenic
929150318 2:38741826-38741848 GCCTTACCAAGATAGACTTTTGG - Intergenic
931158147 2:59658581-59658603 TCCTTTCCAATGGACAGTTGAGG - Intergenic
931616836 2:64167868-64167890 GCCTTTCTATGGGAGAATTATGG - Intergenic
937636225 2:124158196-124158218 TGTTTTCCAAGGGAGGGTTTTGG - Intronic
940279301 2:151973094-151973116 GCTCTTCCAAGGTAGAGTATAGG + Intronic
940357098 2:152755307-152755329 CCCTTTCCCCGGGGGAGTTTAGG + Intronic
941654682 2:168130551-168130573 ACCTTTGCAAGGGAGAGATTTGG - Intronic
943449715 2:188032795-188032817 GACCTTACAAGGTAGAGTTTGGG + Intergenic
945525370 2:210882544-210882566 TCTTTTCCAAGCCAGAGTTTGGG + Intergenic
948183859 2:236003613-236003635 GCAAATCCAAGGGAGAGTGTGGG - Intronic
948830564 2:240596565-240596587 GCCCTTCCAAGGCAGGATTTGGG + Intronic
1168925476 20:1575484-1575506 GCATTTCCTAGAGAGTGTTTGGG - Intronic
1168929354 20:1608512-1608534 GCATTTCCTAGAGAGTGTTTGGG - Intronic
1170301128 20:14885724-14885746 GCATTTCAAAGGAAGAGATTTGG - Intronic
1170581088 20:17700190-17700212 AGCTTTCCTAGGAAGAGTTTGGG - Intronic
1170677106 20:18492606-18492628 GCCTTTCCAATGGAGAAATCAGG - Intronic
1170855286 20:20047548-20047570 GTCTTTTCTAGTGAGAGTTTGGG - Intronic
1171002646 20:21430180-21430202 GCCTTGCCAAGGGAGTGTGGCGG - Intergenic
1171952058 20:31428547-31428569 TTCTTTCCCAGAGAGAGTTTAGG + Intergenic
1172973508 20:38890105-38890127 TCCTTTCCAAGGCAGAGTGATGG + Intronic
1178832251 21:36065759-36065781 GCCTTTTAAAGGGAGAGTGAAGG - Intronic
1180019556 21:45113079-45113101 GCCTTTCCTAGGGATATTTTGGG + Intronic
1181933894 22:26426361-26426383 GCCTTTCAGAGGGGGATTTTGGG - Intergenic
1183791213 22:40071681-40071703 GACATTCCAGGGGACAGTTTGGG + Intronic
1185074086 22:48673859-48673881 GCATTTCCCAGGCAGAGTTAGGG - Intronic
950060126 3:10064018-10064040 GCCTTTCCCAGTTAGAATTTAGG - Intronic
950301492 3:11883241-11883263 GCCTTTCCCAGTTAGAATTTAGG - Intergenic
951256466 3:20455480-20455502 GCATGTCCAAGGTAGAGTATTGG + Intergenic
954640518 3:52095112-52095134 GCCTCGCCAAGTGAGAGATTAGG - Intronic
954654432 3:52185440-52185462 GCCTATCCCAGGGTGAGCTTAGG + Intergenic
955478220 3:59361001-59361023 GTCTTTCAACTGGAGAGTTTAGG + Intergenic
957742997 3:84298855-84298877 ACCTTTTCAAGAGATAGTTTAGG - Intergenic
961024985 3:123547518-123547540 CCCTTTCCAAGTGAGAGTTCTGG + Intronic
964869372 3:161296526-161296548 GGCTTTCCAGGGGGGAATTTGGG + Intergenic
970144584 4:13021654-13021676 ACGTTTCCTAAGGAGAGTTTTGG - Intergenic
970874675 4:20855583-20855605 TCCTTGCCAAGTGAGAGCTTTGG - Intronic
971116504 4:23652618-23652640 GGCTTTACAGGGGAGAATTTGGG - Intergenic
975838808 4:78452969-78452991 GCCCTTGGAAGGCAGAGTTTGGG + Intronic
982898049 4:160959577-160959599 CCATTTACAAGGGAGAATTTTGG + Intergenic
985912060 5:2892495-2892517 GCCTTTCTGAGTCAGAGTTTTGG + Intergenic
988234339 5:28521421-28521443 GCCTTTCCAAGAGAGTTTGTGGG + Intergenic
991576946 5:68114392-68114414 GACTATCCAAGGAAGAATTTTGG + Intergenic
991731326 5:69591880-69591902 TCATTTCTAAGGGATAGTTTTGG + Intronic
991807756 5:70447035-70447057 TCATTTCTAAGGGATAGTTTTGG + Intergenic
991863624 5:71035973-71035995 TCATTTCTAAGGGATAGTTTTGG - Intronic
992536993 5:77716894-77716916 CCTTTTCCAAGTGATAGTTTAGG + Intronic
993946118 5:94118481-94118503 GCCTTTCCTAAAGAGAGTTCTGG - Intergenic
995215678 5:109591818-109591840 GTCATTCCAAGGCAGACTTTGGG - Intergenic
1000915121 5:167072135-167072157 GCCTGTCCAAGGCAGTGTGTAGG - Intergenic
1001100622 5:168810867-168810889 GACTTTCCCTGTGAGAGTTTGGG - Intronic
1001683831 5:173577765-173577787 ACCTTTGCAAGGGAGACATTTGG - Intergenic
1006098403 6:31670608-31670630 GACTTTCCAAGGGAGGGAATAGG + Exonic
1009761778 6:68015938-68015960 TCCTTAACAAGGGAGAGTTCAGG + Intergenic
1011215690 6:85003416-85003438 ATCTTTCCAAGGGAGATTTCAGG - Intergenic
1015510986 6:134037873-134037895 GCATGTCCCAGGGAGAGTTCTGG + Intronic
1019706817 7:2500684-2500706 GTCATTCCAGGGGAGACTTTCGG - Intergenic
1019727452 7:2611005-2611027 GCCGTTCCAAGGGACAGCATAGG + Exonic
1020441592 7:8222638-8222660 GCCTTCCCAAGGGAATGTTTAGG - Intronic
1020573280 7:9893060-9893082 GTCTTTTCATTGGAGAGTTTAGG - Intergenic
1022456591 7:30563622-30563644 CACTTTCCACGGCAGAGTTTGGG - Intergenic
1023315257 7:38929461-38929483 GGCTGTCCAAGGGTGAGTATGGG - Intronic
1028632517 7:92950662-92950684 GCCATTCCATGAGAGAGGTTGGG + Intergenic
1032125838 7:129192198-129192220 GCCTGGCCGAGGGAGAGTTGAGG + Intronic
1032367437 7:131313615-131313637 GCCTTTTCAAGGAGGAGTTTGGG + Intronic
1035532581 8:364964-364986 GCCTCTCTAAGGGAGAGCTCAGG - Intergenic
1035753802 8:2015460-2015482 GCCTTTCGATGGGTGAATTTAGG + Intergenic
1036782493 8:11659191-11659213 CCCTTTTCAAGAGAGAGGTTGGG + Intergenic
1037288965 8:17330731-17330753 GCCATTCGAAGGGAGAATATCGG - Intronic
1037609421 8:20463849-20463871 GCCTTTAGAAGGAAGAGATTTGG + Intergenic
1037660499 8:20922301-20922323 GCCTTACCAGGGGTAAGTTTGGG - Intergenic
1038079922 8:24122641-24122663 GCCTTTCCCTGTGTGAGTTTGGG - Intergenic
1040774557 8:51024356-51024378 GACATTCCAAAGGAGAGTTCAGG - Intergenic
1040874682 8:52138863-52138885 GCCTTTTGAAGGGACATTTTGGG + Intronic
1043380437 8:79696619-79696641 GCCTTTCCTAGGGAGGCTCTGGG - Intergenic
1044445940 8:92275854-92275876 CCCTTTTCAAGGAAGAGTTTGGG + Intergenic
1045964390 8:108007428-108007450 GCCTTTATAATGGAGAGATTTGG + Intronic
1048286047 8:133142565-133142587 GCCTTTCAAAAAGAGAGTTATGG + Intergenic
1051920712 9:22260425-22260447 GCATTGCCAAGGGAAACTTTGGG + Intergenic
1052017750 9:23489113-23489135 TCCTTTTCAAGTGAGGGTTTTGG + Intergenic
1052784068 9:32812481-32812503 TCCTCTCCAAGGGAGAGAGTGGG - Intergenic
1055321270 9:75085798-75085820 GCCTGTCCAAGCCAGTGTTTGGG + Intronic
1057425964 9:94950023-94950045 GTCTCACCAAGGGAGAGTATAGG + Intronic
1059328243 9:113517761-113517783 GCCTTTGCTAGGGAGAGTGGCGG - Intronic
1060475529 9:123983859-123983881 GCGTTTCCCAGGCAGAGATTTGG + Intergenic
1061443597 9:130624428-130624450 GCATTTCCAAGGGAGGGTCTTGG + Intronic
1062205231 9:135332817-135332839 ACCTTTCCAAGGTCGAGTGTGGG - Intergenic
1062422636 9:136490760-136490782 CCCTTTGCAAGTGAGACTTTTGG + Intergenic
1185802999 X:3030217-3030239 GGCTTTCCAAGGGAAAGGTCAGG + Intronic
1186090927 X:6048244-6048266 ACCTTTTCAAAGGAGAGATTGGG - Intronic
1186403238 X:9278691-9278713 GGCTTTCCAAGGAAAAGGTTTGG + Intergenic
1186592286 X:10943790-10943812 TCCTTTCCAAGTGGAAGTTTGGG + Intergenic
1187114280 X:16333181-16333203 GCATTTCCAAGGATGAGGTTTGG + Intergenic
1187204673 X:17170771-17170793 GCCTGTCCATGGGAGTGTTTTGG + Intergenic
1187428717 X:19202670-19202692 GCCTTTCAAATGGGGAGCTTTGG - Intergenic
1187807908 X:23141327-23141349 TTCTTTCCAATGTAGAGTTTGGG + Intergenic
1192599783 X:72449669-72449691 GTCTTTCCAATGGTGTGTTTAGG - Intronic
1195834347 X:109095974-109095996 ACCATTCCAAGGGAGTGCTTTGG - Intergenic
1195878278 X:109564949-109564971 GCATTTTCAAGAAAGAGTTTGGG - Intergenic
1196167651 X:112552969-112552991 GTCCTTACAAGGGAGACTTTTGG + Intergenic
1199134739 X:144236258-144236280 GCCCTTCCACTGGAGAGGTTGGG + Intergenic
1199331333 X:146563722-146563744 GTCTTTCCCAGGGATAGTTGTGG + Intergenic