ID: 1138939747

View in Genome Browser
Species Human (GRCh38)
Location 16:61775971-61775993
Sequence ACTTGGGCTTAGAGAGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138939747_1138939749 -9 Left 1138939747 16:61775971-61775993 CCTCTTTCTCTCTAAGCCCAAGT 0: 1
1: 0
2: 1
3: 23
4: 275
Right 1138939749 16:61775985-61776007 AGCCCAAGTGGTTTGAATAAAGG 0: 1
1: 0
2: 1
3: 14
4: 135
1138939747_1138939752 29 Left 1138939747 16:61775971-61775993 CCTCTTTCTCTCTAAGCCCAAGT 0: 1
1: 0
2: 1
3: 23
4: 275
Right 1138939752 16:61776023-61776045 AAATACAATCCTTTAGATATAGG 0: 1
1: 0
2: 0
3: 21
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138939747 Original CRISPR ACTTGGGCTTAGAGAGAAAG AGG (reversed) Intronic
900181977 1:1315193-1315215 ACTTGGGAAGAGAGAGAAGGAGG + Intronic
903686860 1:25138246-25138268 ACTGAGGCTCAGAGGGAAAGTGG + Intergenic
904473473 1:30749931-30749953 CTCTGGGGTTAGAGAGAAAGGGG + Intronic
905145834 1:35886174-35886196 GCTTGGGCCTAGGGGGAAAGGGG - Intronic
905872538 1:41413308-41413330 ACTGAGGCTCAGAGAGAGAGAGG - Intergenic
906451243 1:45950063-45950085 ACTTGGGGGTGGAGAGAGAGAGG + Intronic
906919060 1:50044042-50044064 ACTGAGGCTCAGAGAGAAAAAGG + Intergenic
907135156 1:52133472-52133494 ACTTGGGCTTTTAGGGAAATGGG + Intergenic
907726586 1:57025888-57025910 ATATGGGCTTTGAGTGAAAGAGG - Intronic
908640015 1:66212247-66212269 ACTTAGGTTATGAGAGAAAGAGG - Intronic
911783951 1:101921011-101921033 ATTTGGGCTTATGGAGAAGGTGG - Intronic
911856263 1:102880150-102880172 ACTAAGACTTAGAGATAAAGTGG - Intronic
912217260 1:107628534-107628556 AGTTGAGCTTAGAGAGAACTTGG - Intronic
915146920 1:153800835-153800857 ACTGGGGCTCAGAGAGTGAGAGG - Intergenic
915305051 1:154972478-154972500 TCTCGGGCATAGAGAGAATGAGG + Intronic
917696165 1:177526282-177526304 GCTGGGGCTTAGTCAGAAAGAGG + Intergenic
919039941 1:192373044-192373066 ACATGGTCTTAGACAGTAAGTGG - Intergenic
920929035 1:210369703-210369725 ACTGGGGCTTGTAGAGACAGAGG + Intronic
921795099 1:219333562-219333584 TCTTGGGTTAATAGAGAAAGGGG - Intergenic
922042636 1:221911680-221911702 ACTTAGCCTTAGAAAGGAAGGGG + Intergenic
922079254 1:222278943-222278965 ACTTGAGCTTAGGGAGGCAGAGG + Intergenic
923001931 1:230013341-230013363 ACTTTGGATTAGAAAGAAAAGGG + Intergenic
923034288 1:230273400-230273422 GCTGGGGCTTAGAGAGGAAGGGG + Intronic
1063489061 10:6446716-6446738 CCCGGGGCTGAGAGAGAAAGGGG - Intronic
1065138686 10:22699352-22699374 ACTTGGTCTAAGAGAGACAGGGG + Intronic
1065581605 10:27177256-27177278 GCTTTGGCTAAGCGAGAAAGAGG - Intronic
1065934752 10:30511438-30511460 GCTTGAGCTCAGAGAGAAAGTGG - Intergenic
1066068358 10:31778775-31778797 AGCTGGGCACAGAGAGAAAGTGG - Intergenic
1069204625 10:65666489-65666511 CCCTGGGCTTAGAGGGAAGGTGG - Intergenic
1071667954 10:87578517-87578539 ATTTGGGCTTTGGGAGGAAGGGG + Intergenic
1071704518 10:87982753-87982775 ACTTGAGTTTTAAGAGAAAGAGG - Intergenic
1072288367 10:93939400-93939422 AATAGGGCTGAGAGAGAAAGAGG - Intronic
1072707994 10:97695992-97696014 ACTTGGGAGGCGAGAGAAAGGGG - Intergenic
1072924595 10:99605824-99605846 ACTCGGGGTTACAGAGAAGGAGG - Intergenic
1073030789 10:100524077-100524099 CCTTGGGCTGAGTGAGGAAGAGG - Exonic
1073760998 10:106628669-106628691 ACTTGGTGTTAGAGAGAAGGTGG - Intronic
1074757049 10:116631888-116631910 AATTGGGCTTAGATATAGAGCGG - Intronic
1075052471 10:119193012-119193034 ACTTGGACTTTGAGAGATAATGG - Intergenic
1075268589 10:121028019-121028041 GCTGGGGCTTAAAGAGAGAGAGG - Intergenic
1075516576 10:123113414-123113436 GCTTTGGCTTTGATAGAAAGAGG - Intergenic
1076017493 10:127039903-127039925 ACATGGTCTTAGAGAGAGGGTGG + Intronic
1077159054 11:1104352-1104374 ATTTGGGCTTTGACAGAGAGGGG + Intergenic
1078898782 11:15622216-15622238 AGTGGGGCACAGAGAGAAAGGGG + Intergenic
1079905552 11:26242389-26242411 ACTTGGCCTTGGAGATTAAGTGG - Intergenic
1081959106 11:47120398-47120420 ACTAAGGCTTAAAGAGTAAGTGG - Intronic
1084181705 11:67450177-67450199 ACTTGGGCTCAGACAGAGGGAGG + Intergenic
1085117968 11:73947048-73947070 ACATGGGGTTAGAAAGGAAGCGG + Intergenic
1085599524 11:77842599-77842621 ACTTGGGATTGGAGAGAAACAGG + Exonic
1086018932 11:82202001-82202023 ACTGAGGCTTAGAGAAAAAATGG + Intergenic
1087167178 11:95016587-95016609 ACAGGGGCATAGACAGAAAGAGG + Intergenic
1089381865 11:118038964-118038986 AGTGGGGCACAGAGAGAAAGGGG + Intergenic
1089840217 11:121410806-121410828 TCTTGAGGTTAGAGAGAATGCGG + Intergenic
1089869285 11:121657672-121657694 ACTTGGCCTTGGAGGGAAATAGG + Intergenic
1092279104 12:7086301-7086323 ACCTGGGCCAAGAAAGAAAGAGG - Intronic
1093114685 12:15194874-15194896 AATTGGTCTTATAGAGATAGTGG - Intronic
1093545363 12:20338746-20338768 ACTTGGGTTTAGAAGGAAGGTGG + Intergenic
1093644971 12:21575172-21575194 ATATGGAATTAGAGAGAAAGAGG + Intronic
1093717005 12:22394100-22394122 ACAGGGGGTTAGAGGGAAAGGGG - Intronic
1094685710 12:32712230-32712252 ACTTGGGCTTTTAGTGAAATGGG - Intronic
1095152334 12:38810141-38810163 ACTTGGACTAAAAGAGAGAGAGG - Intronic
1095219829 12:39597249-39597271 AGTTGGGGGTAGAGAGAGAGTGG - Intronic
1095510510 12:42946667-42946689 ACTTGTCCTTACAGAGCAAGAGG - Intergenic
1097223605 12:57464135-57464157 ACTTGTTCTGAAAGAGAAAGTGG + Intronic
1098454373 12:70655730-70655752 AGTTGGGCTGAGAGAGGAATGGG + Intronic
1101016566 12:100507156-100507178 AATTGGGCTAAGGGAGGAAGGGG + Intronic
1104195696 12:126535282-126535304 ACTGAGGCTCAGAGAGATAGAGG + Intergenic
1106564526 13:30872916-30872938 CCTTGGGATTAGAGAGAGGGTGG - Intergenic
1106848173 13:33760260-33760282 ATCTGGTTTTAGAGAGAAAGAGG + Intergenic
1107507596 13:41050166-41050188 ACTGGGGGTAAGGGAGAAAGGGG - Intronic
1109789112 13:67225290-67225312 ACTTTAGCTTAGTTAGAAAGAGG - Intronic
1110614796 13:77529608-77529630 TCTTGGCCTGAGGGAGAAAGTGG + Intergenic
1110704345 13:78587642-78587664 ACTTTGGCTGAGAGAGGAAAAGG - Intergenic
1114618898 14:24082939-24082961 ACTTGGGCTTTGAGGGAAGAGGG - Intronic
1115352901 14:32414923-32414945 ACTTGTGCTTAAAGCGAAACAGG - Intronic
1116764130 14:49050331-49050353 ACTTGTGCTTAAAGAGAAAAAGG + Intergenic
1117291615 14:54339758-54339780 TTTTGGGCTAAGAGACAAAGTGG - Intergenic
1118891801 14:69916221-69916243 ATTTGGGATATGAGAGAAAGAGG - Intronic
1119885231 14:78134752-78134774 ACTTGAGCATAGTGAGCAAGGGG - Intergenic
1120366214 14:83573796-83573818 AATTGGGATGAGAGAGAAAAGGG + Intergenic
1121120818 14:91374877-91374899 ATCTGGGCTCAGAGACAAAGAGG + Intronic
1121822045 14:96978380-96978402 CCTTGGGCTTGGAGTGAAAAGGG - Intergenic
1121941572 14:98075709-98075731 ACTTCTGCTTCAAGAGAAAGAGG - Intergenic
1122636098 14:103130358-103130380 ACTTGGGCTCACAGATAAAGCGG + Exonic
1124094148 15:26633117-26633139 ACTTGGGATTTGAGAGCAAAGGG - Intronic
1125016479 15:34941765-34941787 TATTGAGCTTATAGAGAAAGGGG - Intronic
1126681327 15:51205038-51205060 ATTAGGGCTTAGATACAAAGTGG + Intergenic
1127321264 15:57848688-57848710 ACATGGGCATAGAGACAAGGTGG - Intergenic
1127332082 15:57949385-57949407 GCCTGGGATTAGAGAGAAAGAGG + Intergenic
1128552977 15:68610025-68610047 ACTCAGGCATAGAGAGAAAATGG + Intronic
1129002154 15:72343940-72343962 CCCTGTGCTTGGAGAGAAAGGGG - Exonic
1131502447 15:92982206-92982228 ACTTGGCCTTGGAAAGAAAAAGG + Intronic
1131647732 15:94363369-94363391 ATTTGGGCTTAGAATGGAAGCGG + Intronic
1132232548 15:100194686-100194708 ATTTGGTTTTAAAGAGAAAGAGG - Intronic
1132739913 16:1406691-1406713 GCTTGGGCTTTGGGAGCAAGAGG - Intronic
1135111112 16:19691500-19691522 ACTTGTGCTTTCAGAGCAAGGGG - Intronic
1137481944 16:48859145-48859167 ACTTGGGCTGAGTGAGGAGGTGG + Intergenic
1137533918 16:49302923-49302945 ACTGGGGGTCAGAGACAAAGGGG - Intergenic
1138939747 16:61775971-61775993 ACTTGGGCTTAGAGAGAAAGAGG - Intronic
1138966046 16:62085267-62085289 ACTTGGGCTTAAAAAAAAATAGG + Intergenic
1141221845 16:82077645-82077667 ACTTGAGCTCAGGGAGATAGAGG + Intronic
1143632421 17:8146765-8146787 GCTGGGGCAAAGAGAGAAAGAGG + Exonic
1144250311 17:13409647-13409669 ACTTGAGCAAAGACAGAAAGTGG - Intergenic
1144450815 17:15377013-15377035 ACTGGGGCTCAGAAAGAAGGAGG - Intergenic
1144802910 17:17943465-17943487 ACTTGGGTATGGAGAGAATGTGG + Intronic
1146954820 17:36931414-36931436 ACTTGGGTTGAGAGACACAGAGG - Intergenic
1147547584 17:41414601-41414623 ACTGGAGCTTAGAGATATAGAGG + Intergenic
1148208310 17:45793337-45793359 CCCTGGGCTTAGAAACAAAGGGG + Intronic
1148352089 17:46948550-46948572 ACTGAGGCTGGGAGAGAAAGAGG - Intronic
1148466343 17:47867308-47867330 AATGAGGCTTAGAGAGAGAGTGG + Intergenic
1148581828 17:48749677-48749699 GCTGAGGCTTAGAGCGAAAGAGG - Intergenic
1148975615 17:51525748-51525770 GCTTGGGCTTAGAGAAGGAGTGG - Intergenic
1149443085 17:56691377-56691399 ACTTAGGCTCAGATAAAAAGGGG - Intergenic
1149450809 17:56748499-56748521 ACAAGGACTTAGGGAGAAAGGGG - Intergenic
1151481160 17:74370705-74370727 ACTTGGGCTTGGCCAGAAATGGG + Intronic
1152014220 17:77739203-77739225 GCTGGGGCTGAGAGAGAGAGAGG - Intergenic
1152258322 17:79253098-79253120 ACTTGGGCTGAAAGAAGAAGGGG - Intronic
1153059746 18:982835-982857 AATTGGCCTTGGAGAGGAAGAGG - Intergenic
1154501896 18:15001411-15001433 CCTTGAGCTTAGGGTGAAAGAGG - Intergenic
1157499737 18:48181265-48181287 CCTTAGCCTTAGAGAGCAAGGGG - Intronic
1158770642 18:60513077-60513099 ACTACGACTAAGAGAGAAAGAGG - Intergenic
1160980297 19:1813503-1813525 ATTTGGGCTTCCAAAGAAAGAGG - Intergenic
1161261794 19:3341847-3341869 ACTGAGGCTGAGAGAGGAAGGGG - Intergenic
1164362935 19:27537754-27537776 ACTGAGGCTTACAGAGAAAAAGG + Intergenic
1165389601 19:35530691-35530713 ACATGGGAATAGAGAGACAGAGG - Intergenic
925292188 2:2755390-2755412 ACTGGAGCTTAGAAAGACAGAGG - Intergenic
926411517 2:12608005-12608027 TCTTGGGCTCAGAGAGAATTAGG - Intergenic
929479241 2:42287463-42287485 ATTTAGGCTAAGAGATAAAGAGG + Intronic
929625334 2:43400992-43401014 ACTGAGACTTAGAGAGACAGAGG - Intronic
930109458 2:47666165-47666187 ACTTTAGCTAAGGGAGAAAGGGG + Intergenic
930618987 2:53624901-53624923 ACTGGGGATCAGCGAGAAAGAGG + Intronic
931911366 2:66903606-66903628 AGTTGGGATGGGAGAGAAAGTGG - Intergenic
932074237 2:68648025-68648047 TCATGGGCTAAGAGAGAAGGTGG - Intronic
934606045 2:95696073-95696095 ACTGGGGCTTAGAGTGATGGTGG - Intergenic
935509951 2:103959278-103959300 CTTTTGGCTTAGAGAGAAAAGGG - Intergenic
936146971 2:109986716-109986738 ACTTGGGCGTATGGAGAAAGGGG + Intergenic
936197721 2:110384767-110384789 ACTTGGGCGTATGGAGAAAGGGG - Intergenic
936350100 2:111706152-111706174 ACTTGGGCTTAGAGGGAAGGTGG - Intergenic
937204016 2:120224207-120224229 ACTGAGGCCCAGAGAGAAAGAGG - Intergenic
937287979 2:120765158-120765180 ACTGGGGTCTAGAGAGACAGTGG - Intronic
937419001 2:121739174-121739196 ACTGGGGTGTACAGAGAAAGTGG - Intronic
938559938 2:132463142-132463164 GCTGGGGCTTAGTGTGAAAGTGG + Intronic
938791649 2:134681496-134681518 AGTGGGGGGTAGAGAGAAAGAGG - Intronic
940061887 2:149580558-149580580 ATCTGGGCTTAGAGAAACAGAGG + Intronic
940212210 2:151266602-151266624 ACTTTGGCTTAGAGGCCAAGTGG + Intergenic
940480326 2:154221010-154221032 ACTGGGGCTTAGAAAGATAAAGG + Intronic
940975237 2:159935700-159935722 ACTTAGGCTTCTTGAGAAAGTGG - Intronic
941306783 2:163879331-163879353 TCTAGGGCTGAGGGAGAAAGGGG + Intergenic
941416280 2:165225380-165225402 ACTTGGCCTAAGAAAGAATGTGG - Intergenic
941773141 2:169364124-169364146 ACTTAGGCTTAAAGAAAAAAAGG + Intergenic
942528739 2:176885414-176885436 ACGGGAGCTGAGAGAGAAAGAGG - Intergenic
942956904 2:181783929-181783951 ATTTGGGCTTAGATAGGAGGGGG + Intergenic
943664746 2:190597317-190597339 ATTTGGGCTAAGAGATAAAGGGG + Intergenic
944985891 2:205176045-205176067 ACTTAGGCGCAGAGAGAGAGAGG + Intronic
946401382 2:219470239-219470261 ACTGAGGCTTAGAGAGATACAGG + Intronic
1170638835 20:18133914-18133936 ATTGGGGCTGAGAGAGAAGGAGG - Intergenic
1172184275 20:33021561-33021583 GCTGGGGCTCAGAGAGAAAAAGG - Intronic
1173777492 20:45722796-45722818 TATTGGGATGAGAGAGAAAGGGG + Intronic
1173845338 20:46184807-46184829 ACTGAGGCTTAGAGAGGAACAGG + Intronic
1174524267 20:51158823-51158845 ACTGAGGCTCAGAGAGGAAGTGG - Intergenic
1174557018 20:51403061-51403083 AGTTGGGCTTCGGGAGAATGTGG - Intronic
1175251390 20:57612060-57612082 GCTCTGGCTTAGAGAGCAAGAGG + Intronic
1175308045 20:57991514-57991536 ACTTGGGCTGGGACAGAATGAGG - Intergenic
1175721269 20:61288926-61288948 ACTGGGGCTTAAAAGGAAAGTGG + Intronic
1176443553 21:6799399-6799421 TCCTGGGCTGAGAGGGAAAGAGG + Intergenic
1178822785 21:35990807-35990829 ACTGAGACTTAGAGAGCAAGGGG + Intronic
1178879721 21:36439680-36439702 ACTTGGGCTAAGAGGGAAAATGG + Intergenic
1178880005 21:36441930-36441952 ACTTGGGCTGAGAGGGAAACAGG - Intergenic
1180864352 22:19107329-19107351 CCTTGGGCTGTGGGAGAAAGTGG - Intronic
1182104601 22:27680517-27680539 AGTTGGACAAAGAGAGAAAGTGG + Intergenic
1182557084 22:31135075-31135097 ACTAAGGCTTAGAGTGCAAGAGG + Exonic
1183394033 22:37561292-37561314 ACTGAGGCTTAGAGAGTAGGGGG + Intronic
1184604091 22:45562355-45562377 ACTGAGGCTCAGAGAGAATGTGG - Intronic
1185343590 22:50302031-50302053 ACTTGGGCTAAGAGGGGCAGTGG + Intronic
950139808 3:10607664-10607686 ACTTGCACTTAGATGGAAAGGGG + Intronic
952305730 3:32144533-32144555 ACTTGGTGTGACAGAGAAAGGGG + Intronic
952783339 3:37126411-37126433 ACTTGGACCTGCAGAGAAAGTGG - Intronic
953410562 3:42688399-42688421 CCTTGTGCTTAGAGTGAAGGTGG + Intronic
953493088 3:43366046-43366068 GCTTGGGCTTGCAGAGAAAAGGG - Exonic
954124725 3:48521632-48521654 CCTTGGGCTCAGTGAGAATGAGG - Intronic
955941395 3:64149857-64149879 ACCTGGCCTTAGAGACTAAGAGG + Intronic
956142828 3:66162897-66162919 GCTTAGGCTCAGAGAGATAGAGG + Intronic
960503628 3:118467126-118467148 GATTGGGCTTACAAAGAAAGTGG - Intergenic
962445732 3:135462470-135462492 ACTTGGGGTTTGGGAGAGAGTGG + Intergenic
962825875 3:139100717-139100739 GCCTGGGCTTAGAGAAACAGAGG - Intronic
964199200 3:154098977-154098999 ACTTTGGTTTAGAGAGGCAGAGG - Intergenic
964891076 3:161536098-161536120 AGTTAGGCATAGAGAGAAAGGGG - Intergenic
967314007 3:188133533-188133555 AGTTTGCCGTAGAGAGAAAGTGG + Intergenic
969039198 4:4281717-4281739 TCTTGGGCTTCCAAAGAAAGCGG + Intronic
970661934 4:18294917-18294939 ACTGGGGCTTTGAGAACAAGAGG + Intergenic
972673045 4:41232289-41232311 ATTTGGGATGTGAGAGAAAGAGG + Intergenic
974809513 4:66927947-66927969 AATTGTGCTGAGAGAGAATGAGG + Intergenic
976749692 4:88441711-88441733 GCTTGGGCTTATAGAGAAATAGG - Intronic
977601899 4:98942480-98942502 AGATTGGCTTAGAGAGAAATGGG + Intergenic
978343419 4:107740678-107740700 ACTTGGGGTTGGAGTGGAAGAGG - Intergenic
979292342 4:118991731-118991753 AATTGTACTTAGAGGGAAAGGGG + Intronic
979485831 4:121269297-121269319 TCTTGGGCTTAGCAAGAAAAAGG - Intergenic
980928672 4:139164061-139164083 AGTGGGGGTGAGAGAGAAAGAGG + Intronic
982526348 4:156483984-156484006 ACTTGGCTTGAGAGAGAAATGGG + Intergenic
983502726 4:168518141-168518163 ACTTGGGGTGTGAGAAAAAGAGG - Intronic
984414453 4:179438868-179438890 ACATGGGGTTAGAGAGCAAAAGG + Intergenic
985627638 5:998171-998193 ACTGGTGATCAGAGAGAAAGAGG + Intergenic
985897672 5:2758745-2758767 CCCTGGGCTTGGAGAGGAAGTGG - Intergenic
985931002 5:3057882-3057904 ACTTGGACTCAGTGGGAAAGAGG + Intergenic
986491458 5:8295651-8295673 CCTGGAGCTTGGAGAGAAAGAGG - Intergenic
986517633 5:8580840-8580862 TCCTGGGGTCAGAGAGAAAGTGG - Intergenic
986984323 5:13482921-13482943 ACTGGGTCTTTGAGAGAGAGGGG - Intergenic
987946936 5:24622095-24622117 ACTTGGGTTGAGAGAGATTGAGG + Intronic
990598604 5:57334965-57334987 ATTTGAGCTTAGAGAGTATGTGG - Intergenic
990873496 5:60459468-60459490 TCTTGGGCTTAGAGAGTACACGG - Intronic
991080131 5:62589558-62589580 ACATGGGAATAAAGAGAAAGGGG - Intronic
993007925 5:82448237-82448259 AATAGGGCTTAGAGGGAAGGAGG - Intergenic
993035908 5:82757097-82757119 ACGTGGGCTTAGATAGGAATGGG - Intergenic
993383362 5:87233523-87233545 ACTTGGGTTTAGAGACTGAGGGG - Intergenic
993697090 5:91074322-91074344 ACTTGAGGGTAGAGGGAAAGAGG - Intronic
994244823 5:97467412-97467434 AGTTGTGCTAAGAGAGAAGGGGG + Intergenic
994825994 5:104713234-104713256 ACTTGGGCTAGCAAAGAAAGAGG + Intergenic
995157163 5:108929575-108929597 AATTGGGCTTACAAAGAAGGAGG + Intronic
995752065 5:115462460-115462482 ACTTGGGGCTACAGAGATAGGGG + Intergenic
995897395 5:117030662-117030684 ACTGGGGTTTAGGGAGAAAGAGG + Intergenic
996406890 5:123114217-123114239 ACCTGGGCTTGGAAAGACAGTGG - Intronic
996539789 5:124618001-124618023 GCCTGGGCTTAGAGTGAAGGAGG + Intergenic
996833326 5:127764107-127764129 ACATGGGCTTTGACAGAAAAGGG - Intergenic
997414105 5:133711836-133711858 CCTTGGGCTTAGAGGAAAAATGG + Intergenic
997494541 5:134311027-134311049 ATTTGGGCTTTGAAAGAAACAGG - Intronic
998059875 5:139111545-139111567 ACTTGGGCTTATAGTGATGGAGG - Intronic
1000125835 5:158243055-158243077 ACTTGGGCTTGGCAGGAAAGAGG + Intergenic
1000224022 5:159240763-159240785 AGTTGGAATTAGAAAGAAAGAGG + Intergenic
1000764743 5:165273008-165273030 ACTTAGACTAAAAGAGAAAGAGG - Intergenic
1002495297 5:179607533-179607555 TCAGGGGCTTAGACAGAAAGTGG + Intronic
1003582926 6:7358958-7358980 ACTAAGGCTTGGAGAGAATGTGG - Intronic
1006921081 6:37627600-37627622 ACTGAGGCTTAGAGAGGAGGAGG - Intergenic
1007269067 6:40621813-40621835 TTTTTGGCTTAGAGAGACAGAGG - Intergenic
1007424130 6:41735745-41735767 ACTAAGGCTTACAGGGAAAGAGG + Intronic
1008141485 6:47837302-47837324 ACCTGTGATTATAGAGAAAGTGG + Intergenic
1008394299 6:50989201-50989223 CTTTGGGCTGAGAGTGAAAGAGG + Intergenic
1008584873 6:52939479-52939501 ACTTGGGGTAAGAAAAAAAGTGG - Intergenic
1008678793 6:53849648-53849670 ACTTGAGCCAAGAGGGAAAGAGG + Intronic
1010115849 6:72309371-72309393 ACTGGGGCTCAGAATGAAAGAGG + Intronic
1010906026 6:81490168-81490190 GCTTGGCTTTAGACAGAAAGGGG + Intergenic
1011375662 6:86683412-86683434 AATTGGGCATTGAGAGCAAGGGG + Intergenic
1012356044 6:98315826-98315848 TCTTGGGGTTAGTGACAAAGGGG - Intergenic
1014140076 6:117931464-117931486 ACATGAGCTTAGAGAGAAATGGG - Intronic
1014545874 6:122734617-122734639 ACTGAGGCGCAGAGAGAAAGTGG + Intergenic
1015283338 6:131457560-131457582 CCTTGTGCTTAGAGAGAATTTGG + Intergenic
1015553624 6:134438224-134438246 ACTGGGGATTAGAGAGAGAACGG + Intergenic
1017965765 6:159264039-159264061 ACTTGGGCTAAGATAGAGACAGG + Intronic
1018750420 6:166799526-166799548 ATTTGAGCTTATAGAGAAAAAGG + Intronic
1019191258 6:170252292-170252314 ACTTGGGCTTTCAGAGGCAGGGG - Intergenic
1022289566 7:28987955-28987977 ACCTGGGGCTAGGGAGAAAGGGG + Intergenic
1023420911 7:39978845-39978867 AGTTAGCCTTAGATAGAAAGAGG + Intronic
1023634632 7:42197476-42197498 ACTTGCTCTTAGAGAGCAGGGGG + Intronic
1023723244 7:43116382-43116404 ACCAGGACTTAGAGAGAAAGTGG - Intronic
1023725462 7:43138684-43138706 ACTTGGTCTAAAAGAGAGAGAGG - Intronic
1023898569 7:44455506-44455528 GATTGGGCTTGGAGGGAAAGAGG - Intronic
1025296024 7:57775877-57775899 ACATGTGCAAAGAGAGAAAGAGG - Intergenic
1026155723 7:67823999-67824021 ACGTGGGATATGAGAGAAAGAGG - Intergenic
1026347694 7:69488990-69489012 ACTTTGCCTTAGAGATAATGAGG - Intergenic
1027833667 7:83214120-83214142 ACTGGTGCTGAGAAAGAAAGTGG + Intergenic
1031321830 7:120339810-120339832 AATTGGCCTCAGTGAGAAAGTGG + Intronic
1032393570 7:131573091-131573113 ACTGGGGCTTAAAAAGAAAAAGG + Intergenic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1035636719 8:1152664-1152686 ACTTGGGTTTGGGGAGAAATGGG + Intergenic
1037139950 8:15507763-15507785 ACTTGGGAAAAGAGAGAGAGAGG + Intronic
1037171259 8:15895117-15895139 ACCTGGGCTGAGAGAGAGAGGGG - Intergenic
1037456032 8:19065303-19065325 ACTTGGTGATGGAGAGAAAGAGG - Intronic
1038386323 8:27150794-27150816 ACTTGTGGTTAGACACAAAGAGG + Intergenic
1041189819 8:55342187-55342209 ACATGGGGTGTGAGAGAAAGAGG - Intronic
1041653312 8:60322652-60322674 AGTTTCCCTTAGAGAGAAAGTGG + Intergenic
1044588164 8:93887222-93887244 ACTTGGGATTTGAGACAATGAGG - Intronic
1047350929 8:124072858-124072880 ACTTGGGTTTTGGGAGAAACAGG + Intronic
1047493091 8:125390264-125390286 ACTAGGGCTGAGGGAGACAGGGG + Intergenic
1050981153 9:12017779-12017801 ACTTGGGCTTTGAGAGTCACAGG - Intergenic
1051097132 9:13478922-13478944 ATTTGGACTGAGATAGAAAGAGG + Intergenic
1051445613 9:17135706-17135728 ACTTGGGCTTGGGGGGGAAGCGG - Intronic
1054766282 9:69045222-69045244 ACACGGGCTTAGAGAGACACAGG + Intronic
1054947551 9:70811881-70811903 CCTTGGCCAGAGAGAGAAAGAGG - Intronic
1055096161 9:72416443-72416465 ACTTGGAACTAGAGAGATAGTGG - Intergenic
1055728458 9:79257161-79257183 AGTGGGGCGGAGAGAGAAAGAGG - Intergenic
1057312112 9:93949111-93949133 ACTTGTGCATAGAGCGGAAGAGG + Intergenic
1057856260 9:98603110-98603132 ATTTGGACTAAGAGAGAAATGGG + Intronic
1058418210 9:104810105-104810127 ATGTGGGCTTAGAGAAAAAGAGG + Intronic
1058736054 9:107895073-107895095 ATTTGGGCTTTGGGAGAATGCGG + Intergenic
1059504001 9:114781469-114781491 TTTTGGGCTGAGAGTGAAAGTGG + Intergenic
1059568476 9:115408441-115408463 TCTTGGGCTTGGAGATACAGTGG + Intergenic
1060226946 9:121797873-121797895 GCTTGAGCTTGGGGAGAAAGGGG + Intergenic
1186314857 X:8358033-8358055 TCTTGAGCTTAAAGAGAAAATGG + Intergenic
1186961619 X:14742994-14743016 ACTGAGGCTTTGAGAGAAACTGG - Intergenic
1188063301 X:25627385-25627407 ATTTGGACTTAGAGACAAACAGG + Intergenic
1189221625 X:39377073-39377095 ACTTGGTCTGAGAGACAATGGGG + Intergenic
1189558068 X:42165832-42165854 ACTTGGGGTTGGGGACAAAGGGG + Intergenic
1192496533 X:71620021-71620043 ACTAGGGGAGAGAGAGAAAGAGG - Intergenic
1192623811 X:72707171-72707193 ACCTGGGGGTAGAGAGAAAGAGG - Intronic
1193149372 X:78108638-78108660 CCTTAGCCTTAGAGAGGAAGGGG + Intronic
1195341500 X:103911321-103911343 ACATGGGCTCAGGGAGAAAAAGG - Intergenic
1195524075 X:105865489-105865511 GTGTGGGCTTAGAGAGATAGTGG + Intronic
1195755642 X:108196348-108196370 AATGGGGCTAAGAGAGAAGGAGG + Intronic
1196421837 X:115530540-115530562 ACTTGGACTCAGAGAGAAGGAGG + Intergenic
1196649259 X:118152255-118152277 ACTTGGGTTTAGGGATTAAGGGG - Intergenic
1197036978 X:121885183-121885205 ACCAGGGGTTAGGGAGAAAGTGG - Intergenic
1197550589 X:127887696-127887718 ACCTGGGCTCCTAGAGAAAGTGG + Intergenic