ID: 1138939943

View in Genome Browser
Species Human (GRCh38)
Location 16:61777991-61778013
Sequence CTAGATCCCCCACTTTAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138939943_1138939946 13 Left 1138939943 16:61777991-61778013 CCTATCTAAAGTGGGGGATCTAG 0: 1
1: 0
2: 0
3: 9
4: 63
Right 1138939946 16:61778027-61778049 ACATGACTATATTCCCAGACAGG 0: 1
1: 0
2: 1
3: 16
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138939943 Original CRISPR CTAGATCCCCCACTTTAGAT AGG (reversed) Intronic
909818650 1:80029274-80029296 CTATATCCACCACTTGATATTGG - Intergenic
911112219 1:94201540-94201562 CTTGATCACCCACTCTAGAGTGG + Intronic
920150919 1:203906763-203906785 TTAGATTCCCTATTTTAGATGGG + Intergenic
1065918195 10:30369290-30369312 TTAAGCCCCCCACTTTAGATAGG - Intronic
1070920777 10:80184425-80184447 CCAGCTCCTCCACTTTTGATGGG - Intronic
1072147639 10:92656616-92656638 CTAAATCCCCCAATATACATGGG - Intergenic
1072991532 10:100199896-100199918 TTAGATCCCCCACATTTGTTAGG + Intronic
1080789660 11:35510937-35510959 CTGGACTTCCCACTTTAGATAGG - Intronic
1082186369 11:49186760-49186782 CTAGATCGCCCTGTTGAGATCGG + Exonic
1082301748 11:50514180-50514202 CCAGATCCACAACTTTAAATTGG + Intergenic
1086045200 11:82524404-82524426 TTAGATTCCCCATTTTAGAGAGG + Intergenic
1086568388 11:88253710-88253732 CTAAATGCCCCACTTAAAATGGG + Intergenic
1090259904 11:125312036-125312058 TCAGATCCAGCACTTTAGATTGG + Intronic
1096552478 12:52382176-52382198 CTAGATCCCAGTCTTTAAATTGG + Intronic
1099808804 12:87554498-87554520 CAAGAGCCTCCACATTAGATTGG - Intergenic
1100217107 12:92462968-92462990 CAAGATCTGCCTCTTTAGATTGG + Intergenic
1101268906 12:103122228-103122250 CTACTTCCCCCACTTTATAAAGG + Intergenic
1110657759 13:78020429-78020451 GTAGATCCACAACTTTGGATAGG + Intergenic
1116803035 14:49463524-49463546 GTAGATCACCCACTGTAAATGGG + Intergenic
1121031563 14:90662649-90662671 CTAGATTCCCCACTGTAAAATGG + Intronic
1129037806 15:72661580-72661602 CTTCAGCCCCCACTTTAGATAGG + Intronic
1129212083 15:74075647-74075669 CTTCAGCCCCCACTTTAGATAGG - Intronic
1129398320 15:75265438-75265460 CTTCAGCCCCCACTTTAGATAGG + Intronic
1129401928 15:75289713-75289735 CTTCAGCCCCCACTTTAGATAGG + Intronic
1129475514 15:75782401-75782423 CTTCAGCCCCCACTTTAGATAGG + Intergenic
1129729210 15:77919968-77919990 CTTCAGCCCCCACTTTAGATAGG - Intergenic
1130358353 15:83156285-83156307 ATAGGTCCCCTATTTTAGATAGG - Intronic
1135905110 16:26504823-26504845 CTATATCACCCACATTAGATTGG + Intergenic
1138863704 16:60791317-60791339 TCAGATTCCCCACTTAAGATCGG + Intergenic
1138939943 16:61777991-61778013 CTAGATCCCCCACTTTAGATAGG - Intronic
1140626853 16:76804503-76804525 CCAGATCACTCACTTTAGAGAGG + Intergenic
1144217223 17:13067176-13067198 CAAGAACCAGCACTTTAGATGGG + Intergenic
1148464248 17:47855574-47855596 CTATGACCCCCACTTTAGAGTGG + Intronic
1149614402 17:57987045-57987067 CTTGCCCGCCCACTTTAGATGGG - Intronic
1149710552 17:58738005-58738027 CTATGTCCCACACTTTATATAGG + Intergenic
1151191955 17:72405178-72405200 GTAGATCACCCACTTTATAGTGG + Intergenic
1163491266 19:17618379-17618401 CTACATCCCCCACCTGGGATGGG + Intronic
929562549 2:42964776-42964798 CTAGATGCCCCACTGTGGAGAGG + Intergenic
942303870 2:174587556-174587578 CTAGACCGCCCACTTTGAATGGG - Intronic
945326131 2:208484958-208484980 CTTGAACCCCCAATTTAGGTGGG + Intronic
946492877 2:220167030-220167052 CTATTTCCCACACTTTGGATTGG - Intergenic
946546026 2:220744787-220744809 CCAGATGCCCCACTTTATGTGGG + Intergenic
1169367015 20:5000694-5000716 CTAGATGCCCCCCCTTGGATGGG - Intronic
1172155607 20:32821709-32821731 CTCCTTCCCCCACTTTACATAGG + Intronic
1172411432 20:34726465-34726487 CATGATCACCCACTTCAGATAGG - Intronic
1172788287 20:37484950-37484972 GTAGGAGCCCCACTTTAGATGGG + Intergenic
1174642998 20:52061357-52061379 CCAGATCCCCCTCCTTAGAGGGG + Intronic
1179968350 21:44819221-44819243 CTAGAGCCCCCACTTAGGAGGGG + Intergenic
1181460836 22:23085078-23085100 CTGGAACCCCCACCTCAGATAGG + Intronic
1181798827 22:25330622-25330644 CTGAATCACCCACTTTAAATGGG - Intergenic
954069088 3:48129877-48129899 CTAGCTTGCCCAATTTAGATGGG + Intergenic
962608224 3:137050348-137050370 CTGGATCCCCCAGATTATATGGG - Intergenic
969350921 4:6597399-6597421 CTAGAGGCCCCACTTTACAGAGG + Intronic
969710584 4:8840846-8840868 CTTGGTCCCCCTCTGTAGATGGG - Intergenic
971483882 4:27140087-27140109 CTAGATTCCCTGCTTTAAATGGG + Intergenic
974150242 4:57997386-57997408 CTAGATTTCCCTCTTTATATTGG - Intergenic
975248308 4:72146539-72146561 CTACATCGTCCTCTTTAGATGGG - Intronic
981770616 4:148303890-148303912 CTAGATCCCCCTGTTAACATGGG + Intronic
982700223 4:158652938-158652960 TTAATTCACCCACTTTAGATGGG + Exonic
984248445 4:177303539-177303561 CTAGGGCCCCCACTTCTGATGGG + Intergenic
987885063 5:23801931-23801953 CTTCATTGCCCACTTTAGATGGG - Intergenic
990321989 5:54639001-54639023 CTATAGGCCTCACTTTAGATTGG + Intergenic
993686426 5:90943549-90943571 ATAGAAGCTCCACTTTAGATGGG - Intronic
998802605 5:145885482-145885504 CTTGATCCTACACTTTAGATGGG - Intergenic
1007060523 6:38936304-38936326 CTTGACCTCCCACTTTAGATGGG + Intronic
1021087445 7:16439146-16439168 CAACATCCTCCACTATAGATGGG + Intergenic
1032870546 7:135979863-135979885 CCAGACCACCCACTTTAAATAGG + Intergenic
1040703026 8:50090321-50090343 CTGAGTCCCCCACTTAAGATGGG - Intronic
1041069684 8:54114780-54114802 TTAGATCTCACACTTTATATAGG - Intergenic
1051495736 9:17720802-17720824 CAAGAACCACCAGTTTAGATAGG - Intronic
1051643225 9:19243014-19243036 CAAGATACCCCCCTTTAAATTGG - Intronic
1187637423 X:21245708-21245730 CTAAATACCCCACTTAAAATTGG + Intergenic
1188884480 X:35532346-35532368 CTAGAACACCCAGTTTAGAGAGG + Intergenic