ID: 1138942644

View in Genome Browser
Species Human (GRCh38)
Location 16:61808854-61808876
Sequence TTGTAAGCATAAAAGGATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 821
Summary {0: 1, 1: 1, 2: 2, 3: 81, 4: 736}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138942641_1138942644 4 Left 1138942641 16:61808827-61808849 CCCAGCACAACAATTTCAACTCT 0: 1
1: 0
2: 3
3: 12
4: 215
Right 1138942644 16:61808854-61808876 TTGTAAGCATAAAAGGATGACGG 0: 1
1: 1
2: 2
3: 81
4: 736
1138942640_1138942644 14 Left 1138942640 16:61808817-61808839 CCACAGTGTTCCCAGCACAACAA 0: 1
1: 0
2: 1
3: 22
4: 231
Right 1138942644 16:61808854-61808876 TTGTAAGCATAAAAGGATGACGG 0: 1
1: 1
2: 2
3: 81
4: 736
1138942642_1138942644 3 Left 1138942642 16:61808828-61808850 CCAGCACAACAATTTCAACTCTG 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1138942644 16:61808854-61808876 TTGTAAGCATAAAAGGATGACGG 0: 1
1: 1
2: 2
3: 81
4: 736

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138942644 Original CRISPR TTGTAAGCATAAAAGGATGA CGG Intronic
900681985 1:3921612-3921634 GTGAAAGGATAGAAGGATGATGG + Intergenic
901614106 1:10524221-10524243 CAGTGAGCAGAAAAGGATGAGGG + Intronic
902589407 1:17462771-17462793 TTGAACGCATGAAAGGAAGAAGG + Intergenic
903752206 1:25631442-25631464 TTTTTATCATAAAAGGATGCTGG + Intronic
904569046 1:31447065-31447087 TTGTAAGTATAGTAAGATGAGGG - Intergenic
905524857 1:38628915-38628937 ATGTAAGCAAAATAGCATGAGGG - Intergenic
905777263 1:40676739-40676761 TTGTTAGCTTAGGAGGATGAAGG - Intergenic
906053646 1:42896473-42896495 TTTTAATCACAAATGGATGATGG + Intergenic
906131184 1:43458238-43458260 TTTTAATCATAAAGGGATGCTGG - Intergenic
906578739 1:46916347-46916369 TTTTAATCATAAAGGGATGCTGG + Intergenic
906594814 1:47066462-47066484 TTTTAATCATAAAGGGATGCTGG - Intergenic
906910819 1:49947486-49947508 TTTTAATCATAAAGGGATGCTGG - Intronic
907030042 1:51162211-51162233 TTTTAATCATAAAAGGATGTTGG - Intergenic
907050810 1:51329137-51329159 ATGTAAGCATATAAGGAAGTGGG + Intronic
907606021 1:55818245-55818267 TTATAAGAATAAAGTGATGAGGG + Intergenic
908174779 1:61544183-61544205 TTTTAATCATAAAGGGATGCTGG + Intergenic
908568406 1:65383017-65383039 TTGTTCTCACAAAAGGATGAGGG + Intronic
908667931 1:66512837-66512859 TTTTAATCATAAAGGGATGCTGG - Intergenic
908820003 1:68076241-68076263 TTTTAATCATAAAGGGATGCTGG + Intergenic
909098629 1:71322184-71322206 TTTTAATCATAAAGGGATGTAGG - Intergenic
909639480 1:77856090-77856112 TTCTAATCATAAAGGGATGCTGG + Intronic
909948040 1:81685832-81685854 TTTTAATCATAAAGGGATGCTGG + Intronic
910141971 1:84036005-84036027 TTTTAATCATAAAGGGATGCAGG + Intergenic
910774160 1:90858326-90858348 TTTTAAGTATAGAAAGATGAAGG + Intergenic
911081026 1:93931161-93931183 TTTTAATCATAAAGGGATGCTGG - Intergenic
911322404 1:96430864-96430886 TTTTAATCATAAAGGGATGCTGG + Intergenic
912064173 1:105715087-105715109 TTTTAATCATAAAAGTATGTTGG + Intergenic
912423919 1:109569080-109569102 TTTTGAGAATAAAAGGAGGAAGG - Intronic
912807413 1:112768240-112768262 CTGTAAGCATAAAAGGGAAATGG + Intergenic
912932028 1:113972784-113972806 TTGTAAGTATGACAGGAAGAGGG - Intronic
913069930 1:115289653-115289675 TTGTATGCAGAGAAGGAAGATGG - Intronic
913143480 1:115965590-115965612 TTTTAATCATAAAGGGATGCTGG - Intergenic
913151679 1:116050534-116050556 TTATAATCATAAAGGGATGCTGG - Intronic
913338049 1:117728397-117728419 TTTTAATCATAAAGGGATGCTGG - Intergenic
914346402 1:146802962-146802984 TTTTAATCATAAAGGGATGTTGG - Intergenic
914387713 1:147187711-147187733 TTGGAATCCTGAAAGGATGAGGG + Intronic
914403969 1:147351370-147351392 ATGTATGCATGAAAGGAAGAGGG - Intergenic
914968289 1:152281442-152281464 TTTTAATCATAAAAGGATGTTGG - Intergenic
915067570 1:153239274-153239296 TTGTAAGAATAAATGGGTGGAGG - Intergenic
916331359 1:163621055-163621077 TTTTAATCATAAAGGGATGATGG + Intergenic
916601812 1:166300373-166300395 TTTTAATCATAAAGGGATGCTGG - Intergenic
917057592 1:171000436-171000458 TTTTAATCATAAAGGGATGCTGG + Intronic
917612914 1:176707459-176707481 TTGTACTCATGAAAGGATCAGGG - Intronic
917780926 1:178396145-178396167 TTGAAAGAATTAAAGAATGAGGG + Intronic
917898151 1:179513261-179513283 TTTTAATCATAAAGGGATGCTGG + Intronic
918172216 1:182009172-182009194 TTTTAATCATAAAGGGATGCTGG - Intergenic
918749601 1:188256504-188256526 TTTTAATCATAAAGGGATGTTGG + Intergenic
919115183 1:193272675-193272697 TTTTAATCATAAAGGGATGCTGG + Intergenic
919197404 1:194304892-194304914 TTATAAACATAAAATGCTGATGG - Intergenic
919214188 1:194531069-194531091 TTTTAATCATAAAGGGATGCTGG + Intergenic
919397967 1:197073892-197073914 TTTTAATCATAAAGGGATGCTGG - Intergenic
919658927 1:200224117-200224139 TTGTATACCTAAAAGGATGGAGG + Intergenic
921001080 1:211043884-211043906 TTTTAATCATAAAGGGATGCTGG - Intronic
921100842 1:211928240-211928262 CTGTAAGAAAAAAAGAATGATGG - Intergenic
921843189 1:219850751-219850773 TTTTAATCGTAAAAGGATGCTGG - Intronic
922069439 1:222176694-222176716 TTTTAATCATGAAAGGATGTTGG - Intergenic
923122555 1:231006412-231006434 TTTTAATCATAAATGGATGCTGG - Intergenic
924437122 1:244051246-244051268 GTGTTAGAATAAAAGGCTGAGGG - Intronic
924830040 1:247584113-247584135 TTTTAATCATAAAAGGATGCTGG - Intergenic
1062978577 10:1703164-1703186 TTAAAAGGAAAAAAGGATGAGGG + Intronic
1063555916 10:7079589-7079611 TTTTAATCATAAAGGGATGCTGG - Intergenic
1064703376 10:18045431-18045453 TGGCAAGAATAAAAGGATGATGG + Intergenic
1064867903 10:19902876-19902898 TTTTAATCATAAAAGAATGCTGG + Intronic
1064907812 10:20366689-20366711 TTTTAATCATAAAGGGATGCGGG + Intergenic
1064953256 10:20878190-20878212 GAGTAAGCAGAAAAGAATGAGGG - Intronic
1065079709 10:22116001-22116023 TTTTAATCATAAAGGGATGCTGG - Intergenic
1065418253 10:25512728-25512750 TTTTAATCATAAAAGAATGCTGG + Intronic
1065465146 10:26012043-26012065 TTTTTATCATAAAGGGATGATGG - Intronic
1066549497 10:36540132-36540154 TTCTAAGGATTAAAGGGTGATGG - Intergenic
1066706471 10:38184716-38184738 TTTTAATCATAAAAGGATGCTGG - Intergenic
1066982835 10:42435291-42435313 TTTTAATCACAAAAGGATGCTGG + Intergenic
1067104219 10:43355085-43355107 TTGTAAGGATTAAAGGCAGAGGG - Intergenic
1067287688 10:44919099-44919121 TTTTAATCATAAAAGAATGTTGG - Intronic
1068099130 10:52530299-52530321 TTTTAATCATAAAGGGATGTTGG - Intergenic
1068161935 10:53275851-53275873 TTTTAATCATAAAGGGATGTTGG - Intergenic
1068184408 10:53565948-53565970 TTTTAATCATAAAACGATGCTGG - Intergenic
1069044493 10:63728314-63728336 TTGTAATCATGAAGGGATGATGG - Intergenic
1069129185 10:64677731-64677753 TTTTAATCATAAAAGGATACTGG + Intergenic
1070427353 10:76302370-76302392 TGGTAAGGAGAAAAGGCTGAAGG + Intronic
1070914916 10:80147279-80147301 TTTTAATCATGAAAGGATGTTGG + Intergenic
1071015524 10:80992900-80992922 TTTTAATCATAAAGGGATGCTGG + Intergenic
1071045686 10:81373237-81373259 TTTTAATCATAAATGGATGTTGG + Intergenic
1071115231 10:82210968-82210990 CTGTAAGTACAAAATGATGATGG - Intronic
1071843778 10:89500590-89500612 TTTTAATCATAAAAGGATGCCGG - Intronic
1071903276 10:90143584-90143606 TGGTAAGTATAAGAGGAGGAGGG + Intergenic
1072008420 10:91281017-91281039 TTATAAGTATAAAAGGGTCAAGG + Exonic
1072414127 10:95232721-95232743 TGGCCAGCATAAAAGGGTGATGG - Intergenic
1072765224 10:98089443-98089465 TTGTAAACATGAGAAGATGATGG - Intergenic
1072872083 10:99131132-99131154 TTTTAATCATAAAGGGATGCTGG - Intronic
1073533047 10:104250601-104250623 ATGTCAACATAAAAGGAAGAGGG + Intronic
1073900162 10:108211612-108211634 TTTTAATCATAAAAGGATGCTGG + Intergenic
1074726048 10:116311133-116311155 TTGTAAACCTCAGAGGATGATGG + Intergenic
1075494104 10:122904105-122904127 TTTTAATCATAAAGGGATGCTGG - Intergenic
1078192321 11:9101495-9101517 CTGTAAGCAAAAAAGAATGTGGG - Intronic
1078405744 11:11068464-11068486 TTTTAGGCCTAAGAGGATGAGGG + Intergenic
1078588283 11:12614085-12614107 TTTTAATGATAAAGGGATGATGG - Intergenic
1078731165 11:13975274-13975296 CAGTAAAGATAAAAGGATGAGGG + Intronic
1078991494 11:16651567-16651589 TTGTAATCATAAAGGGATGCTGG - Intronic
1079805732 11:24928425-24928447 TTATAATCATAAAGGGATGCTGG + Intronic
1079951860 11:26815711-26815733 TTTTAATCATAAAGGGATGCAGG + Intergenic
1080023029 11:27583981-27584003 TTGCAAGAAAAAAAGGAGGAAGG - Intergenic
1080324439 11:31053765-31053787 TTTTAATCATAAAGGGATGCTGG - Intronic
1080486148 11:32709100-32709122 TTTTAATCATAAAGGGATGCTGG + Intronic
1080672210 11:34391249-34391271 TTTTAATCATAAAGGGATGCTGG + Intergenic
1081090774 11:38863603-38863625 TTTTAATCATAAAGGGATGCTGG + Intergenic
1081144584 11:39547090-39547112 TTTTAATCATAAAAGGATGCTGG - Intergenic
1081378892 11:42390915-42390937 ATGCAAGAATAAAAGCATGAAGG + Intergenic
1082111560 11:48281707-48281729 TTTTAATCATAAAGGGATGCTGG + Intergenic
1082206903 11:49447721-49447743 TTTTAATCATAAATGGATGCTGG - Intergenic
1083005439 11:59340725-59340747 TTTTAATCATAAAGGGATGCTGG + Intergenic
1083016995 11:59464521-59464543 TTTTAATCATAAAGGGATGCTGG - Intergenic
1083046354 11:59739241-59739263 TTTTAATCATAAAGGGATGCTGG + Intronic
1083071849 11:59992866-59992888 TTTTAATTATAAAAGGATGCTGG + Intergenic
1083537553 11:63484587-63484609 TTTTAATCATAAAGGGATGCTGG - Intronic
1084220853 11:67677397-67677419 TTTTAATCATAAAAGGATGCTGG - Intronic
1085876315 11:80410308-80410330 TTTTTATCATAAAAGGATGTTGG - Intergenic
1085917489 11:80906962-80906984 TTTTAATCATAAAGGGATGCTGG - Intergenic
1086082478 11:82919293-82919315 TTTTAATCATAAATGGATGCTGG + Intronic
1086648369 11:89254022-89254044 TTTTAATCATAAAGGGATGCTGG + Intronic
1086731908 11:90260768-90260790 AATTTAGCATAAAAGGATGAAGG - Intergenic
1086997548 11:93375481-93375503 TTTTAATCATAAAAGGATGCTGG + Intronic
1087090536 11:94267348-94267370 TTTTGATCATAAAAGGATGCTGG - Intergenic
1087259954 11:96000209-96000231 TTGTAAACAGAAAAGGCTGAAGG + Intronic
1087321777 11:96670247-96670269 TTTTAATCATAAAAGGATGCTGG - Intergenic
1087942617 11:104117175-104117197 TTTTAATCATAAAGGGATGGTGG - Intronic
1088525672 11:110751022-110751044 TTTTAATCATAAAGGGATGCTGG + Intergenic
1088601494 11:111481768-111481790 TTTTAATCATAAATGGATGTTGG - Intronic
1088800379 11:113300930-113300952 TTTTAATCATAAAGGGATGCTGG - Intergenic
1089093849 11:115901462-115901484 CTGGAAACAGAAAAGGATGATGG - Intergenic
1089166647 11:116482612-116482634 ATGGAAGCATAAAGAGATGAAGG - Intergenic
1090406920 11:126481705-126481727 ATCCAAGCACAAAAGGATGATGG - Intronic
1091167961 11:133497098-133497120 TTTTAATCATAAAGGGATGCTGG + Intronic
1091210146 11:133850572-133850594 TTTTAATCATAAAGGGATGCTGG + Intergenic
1091381128 12:61076-61098 TTTTAATCATAAAGGGATGCTGG - Intergenic
1091512863 12:1147311-1147333 TTTTAATCATAAAGGGATGCTGG + Intronic
1092060087 12:5542256-5542278 TTTTAATCATAAAAGGATGCTGG + Intronic
1092667295 12:10816743-10816765 ATGTAAGCAGGAAAGGAGGAAGG - Intergenic
1093468644 12:19477487-19477509 TTTTAATCATAAAGGGATGCTGG + Intronic
1093948765 12:25139988-25140010 TTGTAATCATAAAGAGATGCTGG - Intronic
1093951902 12:25171907-25171929 TTTTAATCATAAAGGGATGCTGG - Intronic
1093964065 12:25306997-25307019 TTTTAATCATAAAGGGATGCTGG - Intergenic
1094297499 12:28924657-28924679 TTTTAATCATAAAGGGATGCTGG - Intergenic
1094555056 12:31490763-31490785 TTGTAAGAGTAAAAGGAAAAAGG - Intronic
1095121144 12:38421080-38421102 TTTTAATCACAAAGGGATGATGG - Intergenic
1095318901 12:40801483-40801505 TTGTGAGCATAAATTGAAGAAGG + Intronic
1095531731 12:43194478-43194500 TTTTAATCATAAAGGGATGCTGG + Intergenic
1096348281 12:50870395-50870417 TTTTAATCATAAAACGATGCTGG - Intronic
1096713901 12:53479239-53479261 TTGCAAGGATTAAAGGATCATGG + Intronic
1097504031 12:60441805-60441827 TTTTAATCATAAAGGGATGCTGG - Intergenic
1097537043 12:60885372-60885394 TTATAATCATAAAGGGATGGTGG + Intergenic
1098472617 12:70862966-70862988 AAGAAAGCATAAAAGGAAGAAGG + Intronic
1098661422 12:73099645-73099667 TTGGAACCATAAAATGGTGATGG + Intergenic
1100203218 12:92321650-92321672 TTTTAATCATAAAGGGATGCTGG + Intergenic
1100683151 12:96952161-96952183 AAGTAAGAGTAAAAGGATGATGG + Exonic
1100696921 12:97104463-97104485 TTTTAATCATAAAGGGATGCCGG + Intergenic
1100835427 12:98562656-98562678 TTGTAATCAGGAAAGGATGCAGG + Intergenic
1100918842 12:99459205-99459227 TTTTAATCATAAAGGGATGCTGG - Intronic
1101014355 12:100484044-100484066 CTCTGAGCATAAAATGATGATGG + Intronic
1101124811 12:101621378-101621400 TTATAAGCATCAAAGTGTGAAGG + Intronic
1101544242 12:105696367-105696389 TTTTAATCATAAATGGATGCTGG + Intergenic
1102916397 12:116756525-116756547 TTTTAATCATAAAGGGATGCTGG + Intronic
1103132407 12:118480651-118480673 CTATAGTCATAAAAGGATGAGGG + Intergenic
1104145285 12:126027597-126027619 TTGGGAGCAAAAGAGGATGATGG + Intergenic
1105598563 13:21863673-21863695 TTTTAATCGTAAAAGGATGCTGG + Intergenic
1105908595 13:24838615-24838637 TTTTAAGCATAAAGGGATGCTGG - Intronic
1105990083 13:25611342-25611364 TTTTAATCATAAAGGGATGGTGG + Intronic
1106362274 13:29042163-29042185 TTTTAATCATAAAGGGATGGTGG + Intronic
1106391936 13:29342856-29342878 TTTTAATCATAAAGGGATGGTGG + Intronic
1107391658 13:39971313-39971335 TTGTTAGCACAAAAAAATGAAGG - Intergenic
1107676286 13:42800866-42800888 TTCCAATCATAAAAGGTTGAAGG + Intergenic
1107849280 13:44554154-44554176 TTGTGAGGATAAAAGGAGAAAGG - Intronic
1108952128 13:56107479-56107501 TTTTAATCATAAAAGGGTGATGG + Intergenic
1109121004 13:58457296-58457318 TTTTAATCACAAAAGGATGCTGG - Intergenic
1109134521 13:58630174-58630196 TTGTAAGCATGATAGAATCAGGG + Intergenic
1109503488 13:63268640-63268662 TTTTAATCATAAAGGGATGCTGG - Intergenic
1109508060 13:63333098-63333120 TTTTAATCATAAAGGGATGCTGG + Intergenic
1109596796 13:64566738-64566760 TTTTAATCATAAAAAGATGCTGG + Intergenic
1109658119 13:65421098-65421120 TTTTAAGCATAAAGTGATGCTGG + Intergenic
1109945661 13:69428233-69428255 TTTTAATCATAAAGGGATGCTGG - Intergenic
1109975929 13:69831892-69831914 TTTTAATCATAAAGGGATGTTGG - Intronic
1111157348 13:84345300-84345322 TTTTAATCATAAAGGGATGCTGG - Intergenic
1111165446 13:84452011-84452033 TTTTAATCATAAAAGGATGCTGG + Intergenic
1111626114 13:90789734-90789756 TTTAAAGCCTAAAAGGATTATGG + Intergenic
1111845212 13:93498912-93498934 TTGTTAGCATAATAGAATGCAGG + Intronic
1111963546 13:94837278-94837300 TTTTAATCATAAAGGGATGCTGG - Intergenic
1114371386 14:22092568-22092590 TTGAAAGAATAAAAGGAACAAGG + Intergenic
1114789579 14:25641829-25641851 TAGTAAGGATAAAAGCATCATGG + Intergenic
1114873875 14:26691131-26691153 TTGTAAGTAGAAAAGGATAGGGG - Intergenic
1115350319 14:32387540-32387562 TTTTAATCATAAAGGGATGCTGG + Intronic
1115392914 14:32873822-32873844 TTTTAATCATAAAGGGATGCTGG + Intergenic
1115894000 14:38063388-38063410 TTGTAAGGATTAAAGGCAGAGGG - Intergenic
1115937812 14:38574439-38574461 TTTTAATCATAAAGGGATGCTGG + Intergenic
1116044653 14:39729763-39729785 TTTTAATCATAAAGGGATGCTGG + Intergenic
1116088713 14:40276093-40276115 TTTTAATCATAAAGGGATGCTGG + Intergenic
1116330742 14:43594747-43594769 TTTTAATCATAAAAGGATGCTGG + Intergenic
1116544058 14:46140749-46140771 TTGGAAGGGTAAAAGGAGGAGGG - Intergenic
1117317528 14:54587584-54587606 TTTTAATCATAAAGGGATGCTGG + Intronic
1117655134 14:57947724-57947746 TTTTAATCATAAAGGGATGTTGG + Intronic
1117768846 14:59111630-59111652 TTTTAATCATAAAGGGATGCTGG - Intergenic
1118085118 14:62405559-62405581 TTGTTAACATAAAAAGATAAAGG + Intergenic
1118106029 14:62660558-62660580 TTATTATCATAAAAGGATGCTGG - Intergenic
1118165933 14:63336339-63336361 TTTTAATCATAAAGGGATGCTGG - Intergenic
1118196901 14:63635422-63635444 TTTTAATCATAAAGGGATGCTGG - Intronic
1118223459 14:63877017-63877039 CTCTAAGGATGAAAGGATGAGGG + Intronic
1118916180 14:70108455-70108477 TTGTAAGAATGAAAAGAGGAAGG - Intronic
1119098789 14:71859895-71859917 TTTTAATCATAAAGGGATGCTGG - Intergenic
1120266849 14:82261694-82261716 TTGTACTCAAAAAAGGATGTTGG + Intergenic
1120471918 14:84936455-84936477 TTTTAACCATAAAGGGATGCTGG - Intergenic
1120776401 14:88442487-88442509 TTTTAATCATAAAGGGATGCTGG + Intronic
1121495334 14:94388292-94388314 CTGTAAGCAGAAGTGGATGAGGG - Intronic
1122171163 14:99876768-99876790 CTGTAAGCAAAAAAGGAGGAGGG - Intronic
1124170158 15:27365973-27365995 TTCTAGGCATAAATGGAAGAAGG + Intronic
1124386432 15:29211675-29211697 TTTTAATCATAAAGGGATGCTGG + Intronic
1125011979 15:34887650-34887672 TTTTAAGCATTAAAGGGTTATGG - Intronic
1125247581 15:37659585-37659607 TGGTAAGCATCAGAGGGTGAAGG + Intergenic
1126060193 15:44773378-44773400 TTTTAATCATAAATGGATGCTGG + Intergenic
1126179724 15:45773257-45773279 TCCTTAGCCTAAAAGGATGAGGG - Intergenic
1126190871 15:45877244-45877266 TTTTAATCATAAAGGGATGCTGG - Intergenic
1126282755 15:46975692-46975714 TTTTAATCATAAAAGGATTCTGG - Intergenic
1126358196 15:47818288-47818310 TTGCAAGCATGAAAGGAAGTCGG + Intergenic
1126566237 15:50103037-50103059 TTTTAATCATAAAGGGATGCTGG - Intronic
1126892065 15:53217229-53217251 TTGTAAGCATAAAAGCATGAGGG + Intergenic
1126924220 15:53564774-53564796 GGGTAAGCATAAAATGATGAAGG + Intronic
1127007879 15:54590989-54591011 TTTTAATCATAAAGGGATGCTGG + Intronic
1127050477 15:55078224-55078246 TTTTAATCATAAAGGGATGCTGG - Intergenic
1127194788 15:56572327-56572349 TTTTAATCATAAAGGGATGCTGG - Intergenic
1127525106 15:59785034-59785056 TTTTAATCATAAAGGGATGCTGG - Intergenic
1128744049 15:70101313-70101335 TGGTAAGCTTAAAGGGATGTTGG - Intergenic
1129021703 15:72525469-72525491 TTGTAATCAAACAAGGATTATGG + Intronic
1130200456 15:81821188-81821210 TTATAAGCCAGAAAGGATGAAGG - Intergenic
1130779874 15:87024923-87024945 TTTTAATCATAAAGGGATGCTGG - Intronic
1131394165 15:92073568-92073590 GTGTAAGCAGGAAAGGATGTGGG - Intronic
1131953000 15:97701992-97702014 TTGAAAGCATAAATGGACCAGGG + Intergenic
1133696631 16:8269727-8269749 TTTTAATCATAAAAGGATGCTGG + Intergenic
1133716553 16:8455211-8455233 TTTTAATCATAAAGGGATGCTGG - Intergenic
1133952770 16:10410909-10410931 TTTTAATCATAAAGGGATGCTGG + Intronic
1134571475 16:15294861-15294883 TTGTAATCATAGAAGACTGAAGG + Intergenic
1134730905 16:16461177-16461199 TTGTAATCATAGAAGACTGAAGG - Intergenic
1134936525 16:18250715-18250737 TTGTAATCATAGAAGACTGAAGG + Intergenic
1135203165 16:20457609-20457631 TTTTAATCATAAGAGGATGCTGG - Intronic
1135215938 16:20570257-20570279 TTTTAATCATAAGAGGATGCTGG + Intronic
1136602688 16:31305660-31305682 TTTTAATCATAAAGGGATGCTGG + Intronic
1138716150 16:59025193-59025215 TTTTAATCATACAAGGATGATGG + Intergenic
1138942644 16:61808854-61808876 TTGTAAGCATAAAAGGATGACGG + Intronic
1139668971 16:68478879-68478901 TTGAAACCATAAAAGAATGTGGG - Intergenic
1139836542 16:69843390-69843412 TTCTAAGTATAAAGAGATGAGGG + Intronic
1139987577 16:70912306-70912328 TTTTAATCATAAAGGGATGTTGG + Intronic
1140253997 16:73319311-73319333 TTGAAAGGATAAAATGATAAAGG - Intergenic
1140548006 16:75830369-75830391 TTTTAATCATAAAAGGATACTGG + Intergenic
1140868901 16:79088853-79088875 CAGTAAGCTTTAAAGGATGAGGG - Intronic
1140998373 16:80283737-80283759 TTTTAATCATGAAAGGATGTTGG - Intergenic
1141031879 16:80596311-80596333 ATGGATGGATAAAAGGATGATGG + Intergenic
1142939356 17:3369433-3369455 TTTTAATCATAAAAGGATGCTGG + Intergenic
1143853092 17:9827602-9827624 TGGGCAGTATAAAAGGATGATGG + Intronic
1146030546 17:29362409-29362431 TGGAAAGCAAAAAGGGATGATGG + Intergenic
1146796389 17:35784339-35784361 TGTTAAGCATAAAAGTATAAGGG - Intronic
1147171675 17:38623702-38623724 TTGCAAGCATATATGGATAAAGG + Intergenic
1147517036 17:41128792-41128814 TTTTAATAATAAAAGGATGCTGG - Intergenic
1149136908 17:53377803-53377825 TTGTCATCATATAAGGATGTTGG + Intergenic
1150093080 17:62347126-62347148 TTTTAACCATAAAGGGATGCTGG + Intergenic
1150876268 17:68973966-68973988 TTGGAAGCATAATATGATCATGG - Intergenic
1151079172 17:71308691-71308713 TTTTAATCATAAAGGGATGTTGG - Intergenic
1152819828 17:82431711-82431733 TTGTAAGAATGAAAGGAGGCCGG - Intronic
1153071581 18:1112055-1112077 TTTTAATCATAAAAGGATGCTGG + Intergenic
1153165223 18:2253986-2254008 TTTTAATCATAAAGGGATGCTGG - Intergenic
1153520645 18:5950200-5950222 TAATAAGCATAAAAATATGAGGG - Intergenic
1155420110 18:25646654-25646676 TTGGAAGAAGAAAAGGAAGAAGG + Intergenic
1155887093 18:31221563-31221585 TTTTAATCATAAAGGGATGCTGG - Intergenic
1156217771 18:35018005-35018027 TTTTTATCATAAAAGGATGTTGG + Intronic
1156327020 18:36083720-36083742 TTTTAATCATAAAGGGATGCTGG - Intergenic
1156564798 18:38175558-38175580 TCTGAAGAATAAAAGGATGAGGG - Intergenic
1156643239 18:39127484-39127506 TTTTAATCATAAAGGGATGCTGG - Intergenic
1156667803 18:39429220-39429242 TTTTAATCATAAAAGGATGCTGG - Intergenic
1156790577 18:40968369-40968391 TTTTAATCATAAAGGGATGCTGG - Intergenic
1157065140 18:44341158-44341180 TTTTAATCATAAAACGATGCTGG - Intergenic
1157541178 18:48508927-48508949 TTTTAATCATAAAGGGATGCTGG - Intergenic
1157912173 18:51626560-51626582 TTGTGAGGATAGAAGGATGGAGG - Intergenic
1158445948 18:57520793-57520815 TTCTAAGTATAAAATAATGAAGG + Intergenic
1159491054 18:69135064-69135086 TTGAAAGTGTAAAAGGATGAGGG - Intergenic
1159612557 18:70542486-70542508 TTTTAATCATAAAGGGATGCTGG + Intergenic
1162729517 19:12709935-12709957 TTGAAAGCTTACAAGGTTGAGGG + Intronic
1163987377 19:20966282-20966304 TTTTAAGCATAAAAGTCTTATGG + Intergenic
1164096577 19:22015389-22015411 TTTTAATCATAAAGGGATGCTGG + Intergenic
1164125380 19:22310398-22310420 TTTTAATCATAAAGGGATGTTGG + Intronic
1164406547 19:27952492-27952514 CTGGCAGCATAAAAGAATGATGG - Intergenic
1164467935 19:28503908-28503930 TTGTAAATATTAAAGTATGAAGG - Intergenic
1165983127 19:39742767-39742789 TTGTAATCATAAAGGGGTGCCGG + Intergenic
1166428797 19:42704436-42704458 TTTTAATCATAAAATGATGCTGG + Intronic
1168611065 19:57800801-57800823 TTGGAAGCATTAAACGATGATGG - Intronic
925127091 2:1466088-1466110 TTTTGATCATAAAAGGATGCTGG + Intronic
925447667 2:3941737-3941759 TTTTAATCATAAAGGGATGCTGG + Intergenic
925657844 2:6168607-6168629 TTGTAACCATAAGAGGATGTAGG - Intergenic
925795398 2:7536194-7536216 TTTTAATCATAAAAGGATGCTGG + Intergenic
926642913 2:15256753-15256775 TTTTAATCATAAAGGGATGCTGG + Intronic
926933637 2:18065235-18065257 TTGAAAGCACAAAAGGACTAGGG - Intronic
927328024 2:21828996-21829018 TTTTAATCATAAAGGGATGTTGG + Intergenic
927599905 2:24431686-24431708 TTGCAAGCATATAGGGAAGAAGG + Intergenic
927802416 2:26113263-26113285 TTTTAATCATAAAAGAATGTTGG - Intronic
928253954 2:29705943-29705965 CTGGAAGCATAAAAGGAAAAGGG + Intronic
928349936 2:30541214-30541236 GTGAAACCATAAAAGCATGATGG - Intronic
928798556 2:35056843-35056865 TTTTAATCATAAAGGGATGCTGG + Intergenic
928856291 2:35806580-35806602 TTCTAATCATAAAGGGATGCTGG - Intergenic
928902548 2:36335954-36335976 CTGTAAGAATAGAAGGATGAGGG + Intergenic
929674867 2:43916526-43916548 TTGAAAGCAAAAAATGATTAAGG - Intronic
930142936 2:47971669-47971691 TTTTAATCATAAAGGGATGCTGG - Intergenic
930453412 2:51574173-51574195 TTGCAATCCCAAAAGGATGAGGG + Intergenic
930657881 2:54024532-54024554 TTTTAATCATAAAGGGATGCTGG - Intronic
931524772 2:63141010-63141032 TTTTAATCATAAAGGGATGCTGG + Intronic
932384557 2:71319615-71319637 TTTTAATCATGAAAGGATGCTGG + Intronic
932461109 2:71882631-71882653 ATGTGAGCCTAAAAGGAAGATGG + Intergenic
933433170 2:82211237-82211259 TTTTAATCATAAAAGGATGCTGG + Intergenic
933523201 2:83401793-83401815 TTTTAATCATAAATGGATGCTGG - Intergenic
935001020 2:99015434-99015456 TTTTAACCATAAAGGGATGCTGG - Intronic
935467430 2:103415772-103415794 TTTTAATCATAAAGGGATGATGG - Intergenic
935610075 2:105013630-105013652 TTTTAATCATAAAGGGATGCTGG + Intergenic
935808059 2:106768449-106768471 TTTTAATTATAAAGGGATGATGG - Intergenic
936996443 2:118419252-118419274 TTGTGAGGTGAAAAGGATGAAGG - Intergenic
937058194 2:118957944-118957966 TTTTAATCATAAAGGGATGCTGG - Intronic
937411012 2:121675643-121675665 TTTTAATCATAAAGGGATGCTGG - Intergenic
937573071 2:123387461-123387483 TTTTAATTATAAAAGGATGTTGG - Intergenic
937751834 2:125484926-125484948 TTTTAATCATAAAGGGATGCTGG + Intergenic
937767306 2:125676636-125676658 TTTTAATTATAAAAGGATGCTGG + Intergenic
938212462 2:129480273-129480295 ATGAAAGCAGAAAGGGATGATGG + Intergenic
938563954 2:132500280-132500302 TTTTAATCATAAAGGGATGCTGG + Intronic
938597934 2:132807953-132807975 TTTTAATCATAAAGGGATGCTGG + Intronic
938853705 2:135288130-135288152 TTTTAATCACAAAAGGATGCTGG + Intronic
939364045 2:141209700-141209722 ATGGCAGTATAAAAGGATGAAGG + Intronic
939463019 2:142521781-142521803 TAGAATGCAGAAAAGGATGATGG + Intergenic
940423390 2:153504581-153504603 TTTTAATCATAAACGGATGCTGG + Intergenic
940618365 2:156080309-156080331 TTTTAATCATAAAGGGATGCTGG + Intergenic
940630613 2:156233677-156233699 TTTTAAGCATAAAGGGATGCTGG - Intergenic
940762715 2:157755053-157755075 TTTTAATCATAAAGGGATGCTGG - Intronic
940784412 2:157966846-157966868 TTTTAATCATAAAGGGATGCTGG + Intronic
940796509 2:158085699-158085721 TTTTAATCATAAAGGGATGCTGG + Intronic
941060971 2:160846671-160846693 TTTTAATCATAAAGGGATGGTGG - Intergenic
941679952 2:168387026-168387048 TTTTAATCATAAAGGGATGCTGG - Intergenic
942339472 2:174928462-174928484 TTGTAAGCATTAATCAATGAGGG + Intronic
942726408 2:179012909-179012931 TTTTAATCATAAAGGGATGCTGG - Intronic
943133041 2:183879495-183879517 TTTTAATCATAAAGGGATGTTGG + Intergenic
943607459 2:189993213-189993235 TTTTAATCATAAATGGATGCTGG + Intronic
943615096 2:190083539-190083561 TTATAGGCAAAAAAGGAAGACGG + Intronic
943638215 2:190329708-190329730 TTTTTATCATAAAGGGATGATGG - Intronic
943654604 2:190494793-190494815 TTTTAATCATAAAGGGATGCTGG - Intronic
944296429 2:198068385-198068407 ATTTAATCATAAAAGGATCATGG - Intronic
944666303 2:201962274-201962296 TTGTATGCATATAAGCAAGAGGG + Intergenic
944914102 2:204340181-204340203 TTGAAAACTTAAAAGAATGAAGG + Intergenic
945536215 2:211021300-211021322 TTTTAATCATAAAGGGATGCTGG + Intergenic
946036802 2:216749818-216749840 TTTTAATCATAAAGGGATGCTGG - Intergenic
946641523 2:221788731-221788753 TTTTAAGGATAAAAGGAAAAGGG + Intergenic
946874839 2:224117890-224117912 TTTTAATCATAAAGGGATGATGG - Intergenic
948554540 2:238798636-238798658 TTGGAAGCACAATAGGAGGAAGG + Intergenic
948898348 2:240940640-240940662 TTTTAATCATAAAGGGATGCTGG - Intronic
1169335823 20:4755712-4755734 TTTTAATCATAAAGGGATGCTGG + Intergenic
1169616198 20:7448471-7448493 TTTTTATCATAAAAGGATGCTGG + Intergenic
1170086554 20:12539178-12539200 GTTTAATCATAAAAGGAGGAGGG - Intergenic
1170917690 20:20643644-20643666 TTTTAAAAATAAAAGGAAGAAGG + Intronic
1171081279 20:22187469-22187491 TTTTAATCATAAAGGGATGCTGG + Intergenic
1171160154 20:22914736-22914758 TTTTAATTATAAAGGGATGAGGG + Intergenic
1171280695 20:23894475-23894497 TTTTAATCATAAAGGGATGCTGG - Intergenic
1171721321 20:28566051-28566073 TTTTAGGCATAAAGGGATGCTGG - Intergenic
1171756749 20:29117510-29117532 TTTTAAGCATAAAGGGATGATGG + Intergenic
1171785519 20:29460412-29460434 TTTTAGGCATAAAGGGATGCTGG - Intergenic
1173080639 20:39863672-39863694 GTTTAAGAATAAAGGGATGAGGG + Intergenic
1173683313 20:44903120-44903142 TTGTAAGCATAAATGTTTAAAGG + Intronic
1173990776 20:47301587-47301609 TTGTCAGGATAAAATGAAGATGG - Intronic
1174185994 20:48706790-48706812 TTTTAAGCAAAAAGGAATGAGGG + Intronic
1174310914 20:49653607-49653629 TTGTAGGGATAAAAGGAACAAGG - Intronic
1175029946 20:55942327-55942349 TTTTAATCATAAAGGGATGCTGG + Intergenic
1175087681 20:56473905-56473927 TTATAAGCATAAACACATGAAGG + Intronic
1176525580 21:7865005-7865027 TTTTAATCATAAAAAGATGCTGG + Intergenic
1176658315 21:9609314-9609336 TTTTAATCATAAAGGGATGCTGG + Intergenic
1177174129 21:17685752-17685774 TTTTAACCATAAAGGGATGCTGG + Intergenic
1177312620 21:19417310-19417332 TTGTAAGCATAATGGAATCAGGG - Intergenic
1177362996 21:20098648-20098670 TTGGAAAAATAAAAGAATGATGG - Intergenic
1177579135 21:22996636-22996658 TTTTAACCATAAACGGATGCTGG - Intergenic
1177621698 21:23603675-23603697 TTGTAACCCTAAATGGAAGAAGG + Intergenic
1177749972 21:25269010-25269032 TTTTAATCATAAAGGGATGCTGG - Intergenic
1177995096 21:28087320-28087342 TTTTAATCATAAAGGGATGTTGG + Intergenic
1178038524 21:28612376-28612398 TTTTAATCATAAAGGGATGTTGG - Intergenic
1178659600 21:34495018-34495040 TTTTAATCATAAAAAGATGCTGG + Intergenic
1178733186 21:35124242-35124264 TTTTAATCATAAAGGGATGCAGG - Intronic
1179083829 21:38198994-38199016 TTTTAATCATAAAAAGATGTTGG + Intronic
1179443611 21:41414897-41414919 TTTTAATCATAAAGGGATGCTGG - Intergenic
1180294863 22:10924708-10924730 TTTTAGGCATAAAGGGATGCTGG - Intergenic
1181122040 22:20676577-20676599 TTTTAATCATAAATGGATGCTGG + Intergenic
1182682691 22:32094037-32094059 TTTTAATCATAAATGGATGCTGG + Intronic
1183048041 22:35236924-35236946 TTTTAATCATAAAGGGATGCTGG + Intergenic
950592075 3:13944381-13944403 TTTTAATCATAAAGGGATGCTGG + Intronic
950593948 3:13961743-13961765 TTTTAATCATAAAGGGATGCTGG + Intronic
950819969 3:15746406-15746428 TTTTAATCATAAAAGGATGCTGG + Intronic
951260362 3:20500428-20500450 TTTTAATCATAAAGGGATGCTGG + Intergenic
951434797 3:22649197-22649219 TTTTAATCATAAAGGGATGCTGG + Intergenic
951443977 3:22755433-22755455 TTTTAATCATAAATGGATGCTGG - Intergenic
951749972 3:26024006-26024028 TTTTAAGCATAAAGCGATGCTGG + Intergenic
951761356 3:26150709-26150731 TTTTAATCATAGAAGGATGCTGG - Intergenic
951852269 3:27154741-27154763 TTTTAATCATAAAGGGATGCTGG - Intronic
952097106 3:29966889-29966911 TTTTAATCATAAAGGGATGCTGG + Intronic
952434879 3:33263209-33263231 TTTTAATCATAAAAGGATGCTGG + Intergenic
952601807 3:35092517-35092539 TTTTAAGCATAAAGTGATGGTGG - Intergenic
952982126 3:38745293-38745315 CTTTAAGCGTAACAGGATGAAGG - Intronic
953185651 3:40635574-40635596 TTTTAATCATAAAAGGATGCTGG - Intergenic
953189194 3:40667923-40667945 TTGTAAGAGTTAAAGGATGCAGG - Intergenic
953248216 3:41216639-41216661 TTCTAAGCATAAAAGCTAGATGG - Intronic
953539783 3:43807268-43807290 TTTTAATCATAAAGGGATGCTGG - Intergenic
953639461 3:44692849-44692871 TTTTAATCATAAAAGGATGCTGG - Intergenic
953723572 3:45377764-45377786 TTTTAATCATAAAGGGATGCTGG + Intergenic
953987260 3:47454057-47454079 TTCTTATCTTAAAAGGATGAGGG - Intronic
955118782 3:56034150-56034172 TTGTAAGCAAAAAAGAATAGGGG + Intronic
955565916 3:60246030-60246052 TTTTAAGCAGAAAATTATGAAGG - Intronic
956305511 3:67820269-67820291 TTGGAAGCAGAGAAGGAAGAAGG + Intergenic
956950575 3:74277561-74277583 TTTTAATCATAAAGGGATGCTGG - Intronic
957427947 3:80064108-80064130 TTTTAATCATAAAGGGATGCTGG - Intergenic
957457107 3:80466130-80466152 TTTTTAACATAAAAGGATGTTGG + Intergenic
957513629 3:81222783-81222805 ATGTAATGATAAAAGGTTGAAGG - Intergenic
957610398 3:82458556-82458578 TTGTAATCATATTATGATGATGG - Intergenic
957681607 3:83443166-83443188 TTTTAATCATAAAGGGATGCTGG - Intergenic
957772404 3:84711350-84711372 TTTTAATCATAAAGGGATGCTGG - Intergenic
958014129 3:87918164-87918186 TTTTAATCATAAAGGGATGCTGG - Intergenic
958480480 3:94639908-94639930 TTGTAATCATAAAAGGATGCTGG + Intergenic
958646811 3:96884921-96884943 TTTTAATCATAAAGGGATGCTGG + Intronic
958775325 3:98475912-98475934 TTTTAATAATAAAAGGATGCTGG + Intergenic
959275006 3:104267517-104267539 TTTTAATCATAAAAAGATGCTGG + Intergenic
959382230 3:105654684-105654706 TTGTAAGCCTAAAAGGAGCAAGG - Intergenic
959721982 3:109502052-109502074 TTATAATCATAAAAGGATGCTGG + Intergenic
959727082 3:109556192-109556214 TTTTAATCATAAAGGGATGCTGG + Intergenic
959765577 3:110023272-110023294 TTTTAATCATAAAGGGATGCTGG - Intergenic
959802224 3:110508959-110508981 TTTTAATCATAAAGGGATGCTGG + Intergenic
959878095 3:111410393-111410415 TTTTAATCATAAAAGGATGCTGG - Intronic
959899433 3:111643275-111643297 TTTTAATCATAAAGGGATGTTGG - Intronic
962147126 3:132851756-132851778 TTTTAATCATAAAGGGATGCTGG + Intergenic
962503058 3:136015021-136015043 TTTTAATCATAAAGGGATGCTGG + Intronic
963050086 3:141134516-141134538 TTTTAATCATAAAGGGATGCTGG + Intronic
963213576 3:142720981-142721003 TTTTAATCATAAAGGGATGCTGG - Intergenic
963687911 3:148461247-148461269 TTTTAATCATAAAGGGATGCTGG - Intergenic
964456764 3:156877019-156877041 TTTTAGTCATAAAAGGATGCTGG + Intronic
964644153 3:158940384-158940406 TTTTAATCATAAAGGGATGCTGG - Intergenic
964772985 3:160244108-160244130 TTTTAATCATAAAGGGATGCTGG - Intronic
964867860 3:161281211-161281233 TTTTAATCATAAAGGGATGCTGG - Intergenic
965019063 3:163202725-163202747 TTGGGAGAATAAAAGAATGATGG + Intergenic
965321608 3:167258670-167258692 TTTTAATCATAAAGGGATGCTGG + Intronic
965435825 3:168649865-168649887 TTGTATGTTTGAAAGGATGATGG - Intergenic
965874060 3:173295969-173295991 TTTTAATCATAAAGGGATGCTGG + Intergenic
966552980 3:181226119-181226141 TTTTAATCATAAAGGGATGCTGG + Intergenic
966948371 3:184794086-184794108 TTTTAATCATAAAGGGATGCTGG + Intergenic
967651835 3:191995189-191995211 TTTTAACCATAAAGGGATGCTGG - Intergenic
967741262 3:193004929-193004951 TTTTAATCATAAAGGGATGGTGG + Intergenic
967958389 3:194897354-194897376 TTTTAATCATAAAGGGATGCTGG + Intergenic
968125214 3:196153931-196153953 TTTTAATCATAAAGGGATGCTGG + Intergenic
968199359 3:196739527-196739549 TTGTAAGCAAAAAAGCAAAATGG + Intergenic
969696821 4:8739786-8739808 TCCTAAGCATGAAAGGATGGAGG + Intergenic
970318867 4:14856087-14856109 GTGTAAGCATGACATGATGATGG + Intergenic
970346411 4:15156861-15156883 TTTTAATCATAAAGGGATGCTGG + Intergenic
970500239 4:16669514-16669536 TTTTAAGTATAAAAGGATAAAGG - Intronic
970605116 4:17672575-17672597 TTTTAATCATAAAGGGATGCTGG + Intronic
970605522 4:17677964-17677986 TTTTAACCATAAAGGGATGCTGG - Intronic
970818290 4:20183956-20183978 TTTTAATCATAAATGGATAAAGG - Intergenic
970938300 4:21601048-21601070 TGGTAAGCATAAAGGGATCTAGG - Intronic
971347770 4:25827050-25827072 GTGTAAACATAGAAGGATCAAGG - Intronic
971509015 4:27400744-27400766 TTTTAATCATAAAGGGATAATGG - Intergenic
971554667 4:27998642-27998664 TTTTAATCATAAAGGGATGCTGG + Intergenic
971694160 4:29876266-29876288 TTTTAATCATAAAGGGATGCTGG + Intergenic
971859165 4:32082238-32082260 TTGTTATCATAAAGGGATGCTGG + Intergenic
971900755 4:32655005-32655027 TTTTAATCATAAAGGGATGATGG + Intergenic
971962223 4:33503819-33503841 TTTTAATCATGAAAGCATGATGG + Intergenic
972097039 4:35360924-35360946 TTTTAATCATAAAGGGATGCTGG + Intergenic
972384965 4:38556582-38556604 TTTTAATCATAAAGGGATGCTGG + Intergenic
972417325 4:38854459-38854481 ATTTAAGCATAAAAAGAGGAAGG + Intronic
972806836 4:42537212-42537234 TTTTAATCATAAAGGGATGCTGG - Intronic
973044139 4:45513829-45513851 TTTTAATCATAAAAGGATGCTGG + Intergenic
973089735 4:46120324-46120346 ATGTAAGAATATAAGGATGAAGG - Intronic
973179271 4:47248213-47248235 TTTTAATCATAAAGGGATGCTGG + Intronic
973244203 4:47992888-47992910 TTTTAATCATAAAAGGATGTTGG + Intronic
973607503 4:52602184-52602206 TTGCAAGGATAAAAGTATGCTGG + Intronic
974127414 4:57713643-57713665 TTTTAATCATAAAGGAATGATGG - Intergenic
974133160 4:57781392-57781414 TTTTAATCATAAAGGGATGCTGG + Intergenic
974327626 4:60435253-60435275 TTTTAATCATTAAGGGATGATGG + Intergenic
974599356 4:64056696-64056718 TTTTAATCATAAAAGGATATTGG + Intergenic
974951232 4:68585074-68585096 TTTTAATCATAAAATGATGCTGG - Intronic
975204424 4:71628138-71628160 TTTTAAACATAAAGGGATGCTGG - Intergenic
975301186 4:72793085-72793107 TTTTAATCATAAAGGGATGCTGG - Intergenic
975517616 4:75264112-75264134 TTTTAATCATAAAGGGATGCTGG - Intergenic
975951317 4:79775260-79775282 TTTTAATCATAAAAGCATGCTGG - Intergenic
976358181 4:84145309-84145331 TTTTAAGGAAAACAGGATGAGGG - Intergenic
976562384 4:86517109-86517131 TTTTAATCATAAAGGGATGCTGG + Intronic
976672720 4:87672117-87672139 TTTTTATCATAAAAGGATGTTGG - Intergenic
976686005 4:87815881-87815903 TTTTAATCATAAAGGGATGCTGG + Intergenic
976888169 4:90011307-90011329 TTTTAATCATAAAGGGATGCTGG - Intergenic
977444900 4:97118707-97118729 TTTTAATCATAAAAGGATGCTGG - Intergenic
977489570 4:97695287-97695309 TTTTAATCATAAAGGGATGCTGG - Intronic
977501725 4:97848559-97848581 TTGAGAGAATATAAGGATGAGGG - Intronic
977904386 4:102458802-102458824 TTTTAATCATAAAAGGATGCTGG - Intergenic
977906891 4:102487393-102487415 TTTTAATCATAAAGGGATGCTGG - Intergenic
978199568 4:106009714-106009736 TTTTAATCATAAAGGGATGCTGG + Intergenic
978380129 4:108118159-108118181 TGGTATGCTTAAAAGGATCATGG - Intronic
978541887 4:109825736-109825758 TAGTAAGCACCAAAGGGTGATGG + Intergenic
978629174 4:110723388-110723410 TTTTAATCATAAAGGGATGCTGG + Intergenic
978759350 4:112338762-112338784 TTGCCAGCATTAAAGGAAGATGG + Intronic
978858173 4:113417141-113417163 TTTTAATCATAAAGGGATGCTGG + Intergenic
978943309 4:114463972-114463994 CTGTAAGTTTTAAAGGATGAAGG - Intergenic
979435049 4:120678265-120678287 TTTTAATCATAAAATGATGCTGG - Intergenic
979984784 4:127300308-127300330 TTTTAATCATAAAATGATGCTGG - Intergenic
979995744 4:127428771-127428793 TTTTAATCATAACAGGATGCTGG - Intergenic
980019691 4:127693770-127693792 TTTTAATCATATAAGGATGCCGG + Intronic
980186773 4:129471858-129471880 TTTTAATCATAAAGGGATGCTGG + Intergenic
980238163 4:130135472-130135494 TTTTAATCATAAACGGATGCTGG - Intergenic
980397570 4:132234354-132234376 TTTTAATTATAAAAGGATGCTGG - Intergenic
980569524 4:134596253-134596275 TTTTAATCATAAAGGGATGATGG - Intergenic
980761105 4:137235240-137235262 TTTTAAACATAAAGCGATGATGG + Intergenic
981256587 4:142668301-142668323 TTGTTTGCATAAAAGGAAGTTGG - Intronic
981258096 4:142687488-142687510 TTCAAAGCAAAAAAGGATGCAGG + Intronic
981461714 4:145020377-145020399 TTTTAATCATAAAGGGATGCTGG - Intronic
981923451 4:150112633-150112655 TTTTTATCATAAAAGGATGCTGG + Intronic
982313122 4:154005869-154005891 TTGAAAGAATAAATGCATGAAGG - Intergenic
982531672 4:156552511-156552533 TTTTAATCATAAATGGATGCTGG + Intergenic
982656215 4:158152794-158152816 TTTTAATCATAAATGGATGCTGG - Intronic
982960100 4:161825089-161825111 TTTTAATCATAAAGGGATGCTGG + Intronic
982984635 4:162191006-162191028 TTTTTATCATAAAAGGATGTTGG + Intergenic
983052590 4:163066139-163066161 TTTTAAGCATAAAGGGATGCTGG - Intergenic
983544564 4:168949564-168949586 TTTTAATCATAAAGGGATGCTGG + Intronic
983685495 4:170403484-170403506 TTTTAATCATAAAGGGATGCTGG + Intergenic
983754956 4:171323713-171323735 TTTTAATCATAAAAGGATGTTGG - Intergenic
983971813 4:173884698-173884720 TTGTAAGCATAATAGTATACCGG - Intergenic
984266347 4:177501630-177501652 TTTTAATCATAAAGGGATGCTGG + Intergenic
985074522 4:186200333-186200355 TTGGATGGATAAAAGAATGAAGG - Intronic
985240400 4:187925338-187925360 TTTTAATCATAAAGGGATGCCGG + Intergenic
985326104 4:188772371-188772393 TTTTAATCATAAAGGGATGCTGG + Intergenic
985417097 4:189746759-189746781 TTTTAATCATAAAGGGATGCTGG - Intergenic
985934794 5:3088944-3088966 TTGTAAACATTTAAGGATGAAGG - Intergenic
986376620 5:7138479-7138501 TTTTAAGTGGAAAAGGATGATGG - Intergenic
986617578 5:9635143-9635165 TTTTAATCATAAAGGGATGCTGG + Intronic
987421768 5:17729008-17729030 TTGGAAGCAGCAAAGGATGCAGG - Intergenic
987563854 5:19559469-19559491 TTTTAACCATAAAAGGATGCTGG - Intronic
987704143 5:21442299-21442321 TTTTAATCATAAAGGGATGCTGG + Intergenic
988173777 5:27693925-27693947 TTTTAATCATAAAGGGATGCTGG - Intergenic
988226217 5:28414240-28414262 TTGGAAGCATCTGAGGATGAAGG + Intergenic
988420811 5:31003834-31003856 TTTTAATCATAAAGGGATGCTGG + Intergenic
988889853 5:35603467-35603489 TTTTAATCATAAATGGATGCTGG - Intergenic
989072865 5:37530019-37530041 TTTTAATCATAAAACGATGTTGG + Intronic
989396335 5:40960984-40961006 TCTTAAGCCTAAAAGGAAGATGG - Intronic
989969611 5:50506898-50506920 TTTTAATCATAAAAAGATGTTGG - Intergenic
990602422 5:57373087-57373109 TTGTAATCATAAAGGGATGCTGG - Intergenic
991155338 5:63427764-63427786 TTTTAATCATAAAGGGATGCTGG + Intergenic
992183773 5:74224082-74224104 TTTTAAACATAAAAGATTGATGG - Intergenic
992339768 5:75811030-75811052 TTTTAATCATAAAGGGATGCTGG + Intergenic
992967453 5:82017601-82017623 TTTTAATCATAAAGGGATGCTGG + Intronic
993314224 5:86379075-86379097 TTTTAATCATAAAGGGATGCTGG - Intergenic
993448098 5:88039677-88039699 TTTTTATCATAAAGGGATGATGG + Intergenic
993948257 5:94140741-94140763 TTTTAATCATAAAGGGATGCTGG + Intergenic
994050991 5:95362199-95362221 TTTTAATCATAAAGGGATGTTGG + Intergenic
994362140 5:98864322-98864344 TTCTAGGAATATAAGGATGATGG + Intronic
994496911 5:100524165-100524187 TTTTAATCATAAATGGATGCTGG - Intergenic
994659280 5:102634144-102634166 TTTTAATCATAAAGGGATGCTGG - Intergenic
994779556 5:104071855-104071877 TTGTTAGCATGAAAGATTGAAGG - Intergenic
994925076 5:106105299-106105321 TTTTAATCATAAAGGGATGCTGG - Intergenic
995351357 5:111179505-111179527 TGGTAATCATAAAGGGATGCTGG + Intergenic
995693558 5:114854817-114854839 TTTTAATCATAAAGGGATGCTGG - Intergenic
995955728 5:117773989-117774011 TTTTAACCATAAAGGGATGCTGG - Intergenic
996110460 5:119560308-119560330 TTTTTATCATAAAAGGATGCTGG - Intronic
996288625 5:121825650-121825672 TTTAAATCATAAAAGGATGTTGG + Intergenic
996292354 5:121867028-121867050 TTGGAAGGATAAATGGCTGATGG - Intergenic
996678660 5:126206003-126206025 TTTTAAACATAAAAAGATGCTGG - Intergenic
996750052 5:126879236-126879258 TTAAAAGCAGAAAAGGGTGAAGG - Intronic
996875084 5:128231800-128231822 TTTTAATCATAAAGGGATGCTGG + Intergenic
997003781 5:129794451-129794473 TTTTCATCATAAAAGGATGCTGG + Intergenic
997185816 5:131880640-131880662 TTTTAAGTATACAAGGATAATGG - Intronic
997763629 5:136476081-136476103 TTTTAATCATAAAGGGATGCTGG + Intergenic
998635038 5:143944050-143944072 TTTTAATCATAAGAGGATGTTGG + Intergenic
998941197 5:147284215-147284237 TTTTAATCATAAAAGGATGCTGG - Intronic
999086418 5:148895361-148895383 TTTTAATCATAAAGGGATGCTGG - Intergenic
999490846 5:152049580-152049602 TTTTAATCATAAAGGGATGCTGG + Intergenic
999544062 5:152607243-152607265 TTTTAAGCATAAAATCAAGACGG - Intergenic
999599562 5:153246791-153246813 TTATAATCATAAAGGGATGCTGG + Intergenic
1000511298 5:162186712-162186734 TTTTAATCATAAAGGGATGCTGG + Intergenic
1000602058 5:163286859-163286881 TGCTATGAATAAAAGGATGATGG - Intergenic
1000615879 5:163426073-163426095 TTTTAATCATAAAGGGATGCTGG - Intergenic
1000757508 5:165180018-165180040 TTTTAATCATAAAGGGATGCTGG + Intergenic
1000780081 5:165469297-165469319 TTTTAATCATAAATGGATGCTGG - Intergenic
1000866096 5:166516882-166516904 CTGTAGTCATAAAATGATGAAGG - Intergenic
1001167040 5:169378674-169378696 TTTTAATCATAAAAGGATGCTGG - Intergenic
1001183934 5:169548897-169548919 TTGGAAGCCTAAAAGAATGTGGG + Intergenic
1001695363 5:173665796-173665818 TTTTAATCATAAAGGGATGCTGG - Intergenic
1001767770 5:174266399-174266421 TTCTCATCATAAAAGGATGCTGG - Intergenic
1002556216 5:180043343-180043365 TTTTAAGCATTGAAGAATGAAGG - Intronic
1002781374 6:369437-369459 TTCTAAGGACAATAGGATGAGGG - Intergenic
1002862013 6:1087752-1087774 ATGTTAAAATAAAAGGATGATGG - Intergenic
1003930045 6:10915518-10915540 TTTTAATCATAAAGGGATGCTGG + Intronic
1004333888 6:14746447-14746469 AAGCAAGCAAAAAAGGATGAGGG + Intergenic
1004378222 6:15109297-15109319 TTGAAAGCATAAAATGCTGTAGG + Intergenic
1004630441 6:17416010-17416032 TTCTAAACAGCAAAGGATGAAGG - Intronic
1005107649 6:22242392-22242414 TTTTAATCATAAAGGGATGCTGG - Intergenic
1005326581 6:24707695-24707717 TTTTAAATCTAAAAGGATGAGGG - Intronic
1005925709 6:30443955-30443977 TTTTAATCATAAAGGGATGCTGG + Intergenic
1005930123 6:30477056-30477078 TTTTAATCATAAAGGGATGCTGG - Intergenic
1008121376 6:47621241-47621263 TTTTAATCATAAAGGGATGCTGG + Intronic
1009395578 6:63195664-63195686 TTTTAATCATAAAAGGATGCTGG + Intergenic
1010358280 6:74961978-74962000 TTTTAATCATAAAAGGATGCTGG + Intergenic
1010413178 6:75583896-75583918 TTTTAATCATAAAATGATGCTGG - Intergenic
1010539445 6:77073036-77073058 TTGTAAGCACAAACTGATTAAGG - Intergenic
1010817222 6:80372646-80372668 TTTTAATCATAAAGGGATGCTGG + Intergenic
1011093182 6:83630048-83630070 TTTTAATCATAAACGGATGCTGG + Intronic
1011168950 6:84482954-84482976 TTTTAATCATAAAAGGATGCTGG - Intergenic
1011319662 6:86077015-86077037 TTTTAATCATAAAGGGATGCTGG + Intergenic
1011490814 6:87889920-87889942 TTATATGCTTAAAAGAATGAGGG + Intergenic
1011947606 6:92925907-92925929 TTTTAATCATAAAGGGATGCTGG + Intergenic
1012081640 6:94765599-94765621 ATGTAAAGATAAAAGGATAAGGG + Intergenic
1012203124 6:96430495-96430517 TTTTAATCATAAAAGAATGTTGG + Intergenic
1012208074 6:96485952-96485974 TTTTAATCATAAAGGGATGCTGG + Intergenic
1013900688 6:115152709-115152731 TTTTAATCATAAAGGGATGCTGG + Intergenic
1013935031 6:115583805-115583827 TTTTAAGGACAAGAGGATGAGGG + Intergenic
1014032050 6:116717390-116717412 TTCTAAGCAAACAAAGATGAGGG - Intronic
1014235439 6:118948878-118948900 TTTTAATCATAAAGGGATGCTGG - Intergenic
1014669577 6:124284533-124284555 TTATAAGAATAAAACCATGAAGG - Intronic
1014853601 6:126371285-126371307 TTTTAATCATAAAGGGATGCTGG + Intergenic
1015198314 6:130549163-130549185 TTGCAAGAATAACAGCATGAAGG - Intergenic
1015565895 6:134570811-134570833 TTGTAATCATAAAGTGATGCTGG - Intergenic
1015662988 6:135596912-135596934 TTTTAATCATAAAGGGATGCTGG + Intergenic
1015849378 6:137556014-137556036 TTTTAATCATAAAGGGATGCTGG + Intergenic
1015914303 6:138200073-138200095 TTTTAATCATAAAGGGATGCTGG + Intronic
1016158667 6:140847404-140847426 TTGTAAGAAAAAAAGGAAGTTGG + Intergenic
1016197130 6:141358011-141358033 TTTTAATCATAAAGGGATGCTGG + Intergenic
1016496762 6:144671855-144671877 TTTTAATCATAAAGGGATGCTGG + Intronic
1016545940 6:145224203-145224225 TTGTAAGCAATAAAGGAAAATGG + Intergenic
1017214580 6:151895580-151895602 TTTTAATCATAAAGGGATGCTGG + Intronic
1017604269 6:156116787-156116809 TTATGAGCACAAAATGATGACGG - Intergenic
1017891235 6:158641043-158641065 TTTTAAGCATAAAAGAATCCTGG - Intronic
1018009778 6:159659553-159659575 TTTTAATCATAAAGGGATGCTGG - Intergenic
1018291114 6:162293341-162293363 TTATAAGATTAAAAGAATGAGGG + Intronic
1020218115 7:6211337-6211359 TTGGAAGCAGAACAGAATGATGG + Intronic
1020332077 7:7028990-7029012 TTTTAATCATAGAGGGATGATGG + Intergenic
1020908200 7:14092771-14092793 TCTTAAGGATAAAAGGATGAGGG - Intergenic
1022134407 7:27433960-27433982 TTCTTAGCTTAAAAGGATGTTGG - Intergenic
1022295669 7:29049960-29049982 TTTTAATCATAAAGGGATGCTGG - Intronic
1022478207 7:30725845-30725867 CTGGAAGCATAAAAGCATGCTGG - Intronic
1023892008 7:44399559-44399581 TTGTGAGGATAAAATGAAGATGG - Intronic
1024304794 7:47919810-47919832 TTTTAATCATAAAGGGATGCTGG - Intronic
1024665253 7:51540162-51540184 TTTTAATCATAAAGGGATGTTGG + Intergenic
1024916901 7:54511753-54511775 TTTTAATCATAAAGGGATGCTGG + Intergenic
1024917783 7:54523206-54523228 TTTTAAGCATAAAGGGATGCTGG + Intergenic
1027623723 7:80523396-80523418 TTGTCAGCATAAATATATGAAGG - Intronic
1027650494 7:80861886-80861908 TTTTAATCATAAAGGGATGCTGG - Intronic
1027693362 7:81375853-81375875 TTTAAATCATAAAAGGATGCTGG + Intergenic
1027732942 7:81899038-81899060 TTTTCATCATAAAGGGATGATGG + Intergenic
1028347784 7:89804413-89804435 TTTTAATCATAAAGGGATGCTGG + Intergenic
1028578445 7:92379953-92379975 TTGGAAGCATAAAGGGTTGGGGG + Intronic
1028885645 7:95929545-95929567 TTGAAAGCGTAAAAGCATGCAGG + Intronic
1029661391 7:101964563-101964585 TTGTGATCAAAAAAGAATGACGG - Intronic
1030050259 7:105531415-105531437 TTGCAAGCATAAAACAAGGATGG - Intergenic
1030255318 7:107504195-107504217 TTTTTATCATAAAAGGATGCTGG + Intronic
1030551836 7:110971328-110971350 TGGTAACCATAAAATGCTGAAGG - Intronic
1030584298 7:111398417-111398439 TTTTAATCATAAACGGATGCTGG - Intronic
1031117804 7:117687179-117687201 GTGTAGGCATAAAAAGGTGAAGG + Intronic
1031220075 7:118954048-118954070 TTTTAATCATAAAGGGATGCTGG + Intergenic
1031234826 7:119161381-119161403 TTTTAATCTTAAAGGGATGATGG + Intergenic
1032258131 7:130313068-130313090 TTATAGTTATAAAAGGATGAAGG + Intronic
1032289010 7:130569999-130570021 TTTTAATCATAAAGGGATGCTGG - Intronic
1032290358 7:130584254-130584276 TTTTAATCATAAAGGGATGCTGG - Intronic
1032900052 7:136296908-136296930 TTGTAAACATAAAAACATGCAGG + Intergenic
1032935995 7:136732261-136732283 TTTTAATCATAAAGGGATGCTGG - Intergenic
1033721649 7:144065940-144065962 TTTTAATCATAAAGGGATGCTGG + Intergenic
1033961248 7:146916015-146916037 TTTTAATCATAAAAGGATGCTGG + Intronic
1034376805 7:150652676-150652698 TTTTAATCATAAAAGGATGCTGG + Intergenic
1036746860 8:11415931-11415953 TTTTAATCATAAAAAAATGAAGG - Intronic
1037320504 8:17637279-17637301 TTTTAATCATAAAGGGATGCTGG + Intronic
1037486259 8:19350121-19350143 GTGTAAGCATAAAATAATAAAGG - Intronic
1037495048 8:19431361-19431383 TTTTTATCATAAAAGGATGTTGG + Intronic
1039087091 8:33790449-33790471 TTGTAAGCATAATAAGAACAGGG + Intergenic
1039239416 8:35538853-35538875 TTTGAAGCATAAAAGTTTGAGGG + Intronic
1039268695 8:35856550-35856572 TTGTAATCATAAAGGAATGCTGG - Intergenic
1039396388 8:37228688-37228710 TTGTCAGCACATCAGGATGAGGG + Intergenic
1039811438 8:41052921-41052943 TTTTAATCATAAAGGGATGCTGG - Intergenic
1040102199 8:43515749-43515771 ATTTAATCATAAAAGGGTGAGGG + Intergenic
1040525858 8:48224650-48224672 TTTTAATCATAAAGGGATGCTGG + Intergenic
1040750315 8:50698226-50698248 TTGTGAGCATATAAGCATAAGGG + Intronic
1040773344 8:51007430-51007452 GTCTTATCATAAAAGGATGATGG - Intergenic
1040966948 8:53092296-53092318 TTTTAATCATAAAGGGATGCTGG + Intergenic
1041150622 8:54929371-54929393 TTTTAATCATAAAGGGATGCTGG - Intergenic
1041206862 8:55508605-55508627 TTGTCAGCCTGGAAGGATGATGG + Intronic
1041347252 8:56912443-56912465 CAGTAAGGAGAAAAGGATGATGG - Intergenic
1041877650 8:62708919-62708941 TTATAATCATAAAGGGATGCTGG + Intronic
1041897444 8:62941706-62941728 TTTTAATCATAAAAGGATGCTGG - Intronic
1042188575 8:66162216-66162238 TTTTAATCATAAAGGGATGCTGG + Intronic
1042429313 8:68686569-68686591 TTTTGATCATAAAAGGATGCTGG - Intronic
1042482590 8:69321110-69321132 TTTTAATCATAAAGGGATGCTGG - Intergenic
1042608280 8:70569238-70569260 TTTTAATCATAAAAGGATACTGG - Intergenic
1042768129 8:72349165-72349187 TTTTAATCATAAAGGGATGCCGG + Intergenic
1042995822 8:74697271-74697293 TTTTAATCATAAAGGGATGTTGG - Intronic
1043568506 8:81574150-81574172 TTTTAATCATAAAGGGATGCTGG + Intergenic
1043642155 8:82467881-82467903 TTTTAATCATAAAAGGATGCTGG - Intergenic
1043672038 8:82898451-82898473 TTTTAATCATAAATGGATGCTGG + Intergenic
1043717293 8:83503494-83503516 TTTTAATCATAAAGGGATGTTGG + Intergenic
1043816557 8:84809179-84809201 TTTTAACCATAAAAGGATGCTGG + Intronic
1044292190 8:90485783-90485805 TTTTAATCATAGAAGGATGCTGG - Intergenic
1044620147 8:94182559-94182581 TTTTTATCATGAAAGGATGACGG - Intronic
1045350075 8:101330448-101330470 TTCTAAGTATAAAAGAATGCTGG + Intergenic
1045559205 8:103244675-103244697 CTGTAAGCACAGAATGATGAAGG + Intergenic
1045813859 8:106256903-106256925 TTGTAACCATAAAGGAATGCTGG + Intergenic
1045878238 8:107007927-107007949 TTTTAATCATAAAGGGATGCTGG - Intergenic
1045943224 8:107763787-107763809 TTGTAAGCATGAAATGAAGCAGG + Intergenic
1046104997 8:109654516-109654538 ATGAAAGAATAAAAGGGTGAGGG - Intronic
1046352159 8:113029569-113029591 TTTTAATCATAAATGGATGCTGG - Intronic
1046985877 8:120388063-120388085 TTTTAATCATAAAAAGATGCTGG + Intronic
1047798266 8:128280873-128280895 TTTTAATCATAAAGGGATGCTGG - Intergenic
1047839158 8:128730388-128730410 TTGTTATCATGAAAGGATGTTGG + Intergenic
1047981027 8:130182310-130182332 TTGAAGACAAAAAAGGATGACGG + Intronic
1048530737 8:135247333-135247355 TTTTAATCATAAAGGGATGCTGG + Intergenic
1049295676 8:141834766-141834788 TTTTAATCATAAAGGGATGCTGG + Intergenic
1049869262 8:144960776-144960798 TTTTAATCATAAAGGGATGCTGG + Intergenic
1050147700 9:2587154-2587176 TTTTAATCATAAAAGGATGTTGG - Intergenic
1050403340 9:5280591-5280613 TTGTTAGCATAAAGGGGTGTTGG - Intergenic
1050511063 9:6396342-6396364 TTGTAATCTTAAAAGGAAGGTGG + Intergenic
1050548464 9:6728903-6728925 TTGTATGAAAAAAAGGAAGAAGG + Intronic
1052010953 9:23408784-23408806 TTAAAAGCATAAATGGATGTTGG - Intergenic
1052307143 9:27023356-27023378 TTTTAATCATAAAAGGATGCTGG + Intronic
1052624593 9:30958889-30958911 TTTTAATCATAAAGGGATGCTGG + Intergenic
1052671230 9:31560107-31560129 TTCAAAGTATGAAAGGATGACGG + Intergenic
1052727251 9:32244256-32244278 TTTTAAACATCAAAGGATAAGGG - Intergenic
1052731153 9:32287769-32287791 TTTTAATCATAAAGGGATGCTGG + Intergenic
1052837040 9:33258604-33258626 CTGTGAGCATAAATGGATGCTGG + Intronic
1052951132 9:34213144-34213166 TTCTAATCATAAAGGGATGCTGG - Intronic
1053044571 9:34904421-34904443 TTTTAATCATAAAGGGATGCTGG + Intergenic
1053126768 9:35587560-35587582 TTTTAATCATAAAGGGATGCTGG - Intergenic
1053212220 9:36240358-36240380 TTTTAATCATAAAGGGATGCTGG + Intronic
1055138212 9:72847856-72847878 TTTTAATCATAAAGGGATGCTGG - Intergenic
1055905485 9:81288958-81288980 TTTTAATCATAAAGGGATGCTGG + Intergenic
1055906718 9:81303227-81303249 TTTTAATCATAAAGGGATGCTGG - Intergenic
1057113136 9:92493156-92493178 TTGTAAGAAGAAAAGGGGGATGG + Intronic
1057476032 9:95402959-95402981 TTTTAATCATAAAGGGATGCTGG - Intergenic
1058111985 9:101040798-101040820 ATGTAAGCATCATAAGATGAGGG + Intronic
1058160049 9:101560097-101560119 TTTTAATCATAAAAGGATGCTGG + Intronic
1058396342 9:104558117-104558139 TTTTAATCATAAAGGGATGCTGG - Intergenic
1058410789 9:104728893-104728915 TTTTAATCATAAAAGGATGCTGG - Intergenic
1058622868 9:106902116-106902138 TTTTAATCATAAAGGGATGCTGG + Intronic
1058784269 9:108370949-108370971 TTTTAATCATAAAGGGATGCTGG + Intergenic
1059075116 9:111184852-111184874 TTCTAATCATAAAAGGATGTTGG + Intergenic
1059172112 9:112135091-112135113 TTGCAAGCATAAAAGAAAAATGG + Intronic
1059254955 9:112921446-112921468 TTCAAAGCATAAATGGAGGATGG + Intergenic
1059307905 9:113369016-113369038 TTGTAAGGATAATACGAGGAGGG - Intronic
1059609263 9:115874801-115874823 TTTTAATCATAAAGGGATGCTGG + Intergenic
1060314147 9:122492906-122492928 TTTTAATCGTAAAAGGATGCTGG + Intergenic
1060477498 9:123997444-123997466 GTTTAAACATAGAAGGATGAAGG - Intergenic
1203446297 Un_GL000219v1:59641-59663 TTTTAATCATAAAGGGATGCTGG - Intergenic
1203636045 Un_KI270750v1:112889-112911 TTTTAATCATAAAGGGATGCTGG + Intergenic
1186308741 X:8293836-8293858 TTTTAATCATAAAGGGATGCTGG - Intergenic
1186596660 X:10988989-10989011 TTCTATGCAGAAAAGGAAGAAGG + Intergenic
1186597909 X:11004391-11004413 TTGTAAGCAGAAAACTATAAAGG - Intergenic
1186625556 X:11289583-11289605 TTGTCAACATAAAAAGATGTTGG - Intronic
1186792467 X:13012399-13012421 TTAAAAGCAAAAAAGGAAGATGG + Intergenic
1187636507 X:21235032-21235054 TTTTAATCATAAAGGGATGCTGG + Intergenic
1187681706 X:21774082-21774104 TTTTAATCATAAAGGGATGCTGG - Intergenic
1187784083 X:22865021-22865043 TAGAAAATATAAAAGGATGATGG + Intergenic
1187909611 X:24098927-24098949 TTGTAGACATCAAAGGATAAGGG - Intergenic
1188389007 X:29596928-29596950 TTTTAATAATAAAGGGATGATGG + Intronic
1188623051 X:32250264-32250286 TTGTAAGCAGAAGAGGAAGTGGG - Intronic
1188889885 X:35596708-35596730 TTTTAATCATAAAGGGATGTAGG - Intergenic
1189962407 X:46336808-46336830 TTTTAATCATAAAGGGATGCTGG - Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1190967614 X:55316066-55316088 TTTTAACCATAAAGGGATGTTGG + Intergenic
1191168644 X:57418685-57418707 TTGAAAGAATAAAAGGGTGCAGG - Intronic
1191223004 X:58010788-58010810 TTATAATCATAAAGGGATGCTGG + Intergenic
1191806687 X:65143390-65143412 TTTTAATCATAAAGGGATGCTGG + Intergenic
1191909094 X:66128106-66128128 TTTTAATCATAAAAGGATGCTGG + Intergenic
1191909104 X:66128222-66128244 TTTTAATCATAAAAGGATGCTGG + Intergenic
1192031669 X:67520382-67520404 TTTTAATCATAAAGGGATGCTGG - Intergenic
1192037988 X:67586607-67586629 TTGGAAGCCTGAAAGGTTGAAGG - Intronic
1192058181 X:67794701-67794723 TTCTAGGCATGAAAGGATGAAGG + Intergenic
1192148906 X:68699774-68699796 TGGTAACCAGAAAAGGATTATGG - Intronic
1192298395 X:69874437-69874459 TTTTAAACATAAAGGGATGATGG - Intronic
1192700855 X:73470176-73470198 TTTAAATCATAAAAGGATGTTGG + Intergenic
1192895196 X:75435538-75435560 TTTTAATCATAAAGGGATGCTGG + Intronic
1192901075 X:75497770-75497792 TTTTAATCATAAAGGGATGCGGG - Intronic
1192904019 X:75530391-75530413 TTTTTAACATAAAGGGATGATGG + Intergenic
1192985115 X:76390399-76390421 TTTTAATCATAAATGGATGCTGG + Intergenic
1193015684 X:76731059-76731081 TTTTAATCATAAAGGGATGCTGG - Intergenic
1193134908 X:77960078-77960100 TTGTATCCAAAAAAGGATTAAGG + Intronic
1193182452 X:78474055-78474077 TTGTAATCATAAAATGATGCTGG + Intergenic
1193185841 X:78511419-78511441 TTTTAATCATAAAGGGATGCTGG - Intergenic
1193578823 X:83236352-83236374 TTTTAATCATAAACGAATGACGG - Intergenic
1193590046 X:83377945-83377967 TTTTAATCATAAATGGATGACGG + Intergenic
1193791947 X:85825351-85825373 TTTTAATCATAAAGGGATGTTGG - Intergenic
1193814431 X:86087775-86087797 TTTTAAGCATAAAGCGATGCTGG - Intergenic
1193950664 X:87793960-87793982 TTTTAATTATAAAAGGATGCTGG + Intergenic
1193965416 X:87979315-87979337 TTTTTATCATAAAAGGATGCTGG - Intergenic
1194012248 X:88576731-88576753 TTTTAATCATAAAGGGATGCTGG + Intergenic
1194028137 X:88779591-88779613 TTTTAATCATAAAGGGATGCTGG + Intergenic
1194214005 X:91106079-91106101 TTTTAAACATAAAGGGATGCTGG + Intergenic
1194347187 X:92780648-92780670 TTTTAATCATAAATGGATGCTGG - Intergenic
1194381396 X:93196077-93196099 TTTTAATCATAAAAGGATGCTGG - Intergenic
1194557200 X:95374867-95374889 TTTTAATCATAAAAGAATGCTGG - Intergenic
1194630574 X:96278080-96278102 TTTTAATCATAAAGGGATGCTGG - Intergenic
1194770146 X:97893305-97893327 TTTTAATCATAAAGGGATGCTGG + Intergenic
1194861375 X:99002769-99002791 TTATAAGTAAAAAAGGAAGATGG + Intergenic
1194867992 X:99092791-99092813 TTTTAATCATAAAGGGATGCTGG + Intergenic
1194970123 X:100333620-100333642 TTGAAAGCATTAGAGGATGCAGG - Intronic
1195076576 X:101332666-101332688 TTTTAATCATAAAGGGATGCTGG - Intergenic
1195237409 X:102915097-102915119 TTTTAATCATAAAGGGATGCTGG - Intergenic
1195267290 X:103195027-103195049 GTGTAAACTTAAAAGGATTAGGG + Intergenic
1195556689 X:106235027-106235049 TTTTAATCATAAAGGGATGCTGG - Intergenic
1195837670 X:109136773-109136795 TTTTTATCATAAAAGGATGTTGG - Intergenic
1196051933 X:111314811-111314833 TTGTTAACATGAAAGGATGTTGG - Intronic
1196053388 X:111329606-111329628 TTTCAAGCAAAAAAGGCTGATGG + Intronic
1196081999 X:111642389-111642411 TTTTTATCATAAAAGGATGTTGG + Intergenic
1196590229 X:117478664-117478686 TTTTAATCATAAAAGGATGCGGG + Intergenic
1197121586 X:122899475-122899497 TTATTATCATAAAAGGATGTTGG + Intergenic
1197169879 X:123420411-123420433 TTCTAAGCACAAAAGGAACAGGG - Intronic
1197476001 X:126926164-126926186 TTTTAATCATAAAGGGATGCTGG + Intergenic
1197506363 X:127309734-127309756 TTTTTAGCATGAAAGGATGCTGG - Intergenic
1197664295 X:129206910-129206932 TTTTAATCATAAAGGGATGCTGG + Intergenic
1197878755 X:131141979-131142001 TTTTAATCATAAAGGGATGCTGG + Intergenic
1198451941 X:136775490-136775512 TTTTAATCATAAAGGGATGCTGG - Intronic
1198510613 X:137347460-137347482 TTTTAATCATAAAGGGATGCTGG - Intergenic
1198583204 X:138090213-138090235 TTTTAATCATAAAGGGATGCTGG - Intergenic
1198616826 X:138467128-138467150 TTTTAATCATAAAGGGATGTTGG - Intergenic
1198665058 X:139011632-139011654 TTTTAATCATAAACGGATGCTGG - Intronic
1199101920 X:143812056-143812078 TTTTAACCATAAAGGGATGCTGG + Intergenic
1199587163 X:149427377-149427399 TTTTAATCATAAAGGGATGCTGG - Intergenic
1200655515 Y:5897284-5897306 TTTTAATCATAAATGGATGCTGG - Intergenic
1201316089 Y:12647325-12647347 TTTTTATCATAAAAGGATGCTGG - Intergenic
1201721897 Y:17107931-17107953 TTGTGAGTATAAATCGATGATGG - Intergenic
1201861757 Y:18605632-18605654 TTGTATGGCTAAGAGGATGATGG - Intergenic
1201871566 Y:18714748-18714770 TTGTATGGCTAAGAGGATGATGG + Intergenic
1201903835 Y:19069464-19069486 TTGTAATCACAAGAGGAAGAGGG + Intergenic