ID: 1138942909

View in Genome Browser
Species Human (GRCh38)
Location 16:61811715-61811737
Sequence CAGGATCTCCTTGTTTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5739
Summary {0: 3, 1: 7, 2: 157, 3: 1134, 4: 4438}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138942909_1138942911 8 Left 1138942909 16:61811715-61811737 CCTTTAAAAACAAGGAGATCCTG 0: 3
1: 7
2: 157
3: 1134
4: 4438
Right 1138942911 16:61811746-61811768 AACAACATGAATGAATGTTAAGG 0: 1
1: 1
2: 15
3: 152
4: 1034

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138942909 Original CRISPR CAGGATCTCCTTGTTTTTAA AGG (reversed) Intronic
Too many off-targets to display for this crispr