ID: 1138942987

View in Genome Browser
Species Human (GRCh38)
Location 16:61812844-61812866
Sequence GTGATATAGCACGTAAACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 19}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138942987 Original CRISPR GTGATATAGCACGTAAACGC AGG (reversed) Intronic
911807825 1:102234269-102234291 GTGATACAGCTCATAAAGGCAGG + Intergenic
916469638 1:165110384-165110406 GTCATATAGCAATTAAATGCTGG + Intergenic
920906838 1:210178458-210178480 GGGAAATAGCACATGAACGCAGG + Intergenic
1073803841 10:107073667-107073689 GTCATATAGCTAGTAAATGCTGG + Intronic
1078895392 11:15592810-15592832 GTGATTTGGCAGGTAAATGCTGG + Intergenic
1092859603 12:12709164-12709186 GTGCTATAGAACGTAAATGTAGG + Intergenic
1138942987 16:61812844-61812866 GTGATATAGCACGTAAACGCAGG - Intronic
1143691152 17:8567117-8567139 GTGATATAGCCACTAAACACAGG + Intronic
1158366480 18:56743163-56743185 GTGATATCGAATGTAAAAGCAGG + Intronic
1159989997 18:74894453-74894475 GTGTTATAGTAAGTAAACGTTGG + Intronic
925111331 2:1340966-1340988 GAGATACTGCACGTAAACTCTGG - Intronic
934583386 2:95466004-95466026 GTGTTATAGCTCATAAACACGGG - Intergenic
934596064 2:95610710-95610732 GTGTTATAGCTCATAAACACGGG + Intergenic
934786711 2:97014768-97014790 GTGTTATAGCTCATAAACACGGG - Intronic
934890743 2:98066921-98066943 CTGCTATAGCACCTAAACTCTGG - Intergenic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
993870853 5:93252508-93252530 GTGATATAGGAGGTTACCGCAGG - Intergenic
995300094 5:110569889-110569911 ATGATAGAGCAGGTAAAGGCTGG + Intronic
1200403360 Y:2782687-2782709 GTGAAATAGCACAAAAACCCTGG + Intergenic
1201900958 Y:19045858-19045880 GTGTTACAGCTCTTAAACGCAGG + Intergenic