ID: 1138947752

View in Genome Browser
Species Human (GRCh38)
Location 16:61872743-61872765
Sequence GAGGAGGGCAGGTACTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 384}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138947742_1138947752 22 Left 1138947742 16:61872698-61872720 CCTAAACTAGTGTTTTCAGGTTA 0: 1
1: 1
2: 10
3: 25
4: 194
Right 1138947752 16:61872743-61872765 GAGGAGGGCAGGTACTCAGATGG 0: 1
1: 0
2: 1
3: 44
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138947752 Original CRISPR GAGGAGGGCAGGTACTCAGA TGG Intronic
901399677 1:9007291-9007313 GAGGCGTGCAGGTACTCACTGGG + Exonic
901862936 1:12086455-12086477 GAGGGGGGCAGGTACTTGGATGG - Intronic
902372073 1:16013423-16013445 GAGGAGGGGAGGGGATCAGAGGG - Intergenic
902744836 1:18466870-18466892 GCGGAGGGCAGCCACTGAGAAGG + Intergenic
903489904 1:23720458-23720480 TAGGAGGCCAGGTTCTCAGCAGG - Intergenic
903848072 1:26290309-26290331 GAGGAGGAAATGAACTCAGAGGG + Intronic
903996694 1:27309719-27309741 GAGAATGGCATGAACTCAGAAGG - Intergenic
904205388 1:28851524-28851546 GAGGAGGACAGGTGCGCAGCTGG + Intronic
904272860 1:29361971-29361993 GTGCAGGGTAGGAACTCAGAGGG + Intergenic
904565983 1:31428749-31428771 GAGGAGGGCAAGTAATCTGAGGG + Intronic
905033002 1:34900149-34900171 GAGGAGAGCGGAGACTCAGACGG - Exonic
905143352 1:35867025-35867047 GTGGAGGGCAGATTCTAAGATGG + Intergenic
905222852 1:36460818-36460840 GAGGAGGGCTAGTTCTTAGAGGG - Intronic
905858461 1:41330475-41330497 GAGAAGGGCAGGTGGTCAGGAGG + Intergenic
905897329 1:41557420-41557442 GATGAGGGCAGTTTCCCAGAGGG + Intronic
905905306 1:41614109-41614131 GGGCAGTGCAGGGACTCAGATGG + Intronic
905938930 1:41847641-41847663 GAGTAGGGCAGGCACTAAAAAGG + Intronic
906193136 1:43911775-43911797 GAGGATGGCAGGGCCCCAGAAGG - Intronic
906522249 1:46474543-46474565 GAGGCAGGGAGGTTCTCAGATGG - Intergenic
907342648 1:53747914-53747936 GTGGAGAGCAGGTGCTCAGAAGG - Intergenic
908658473 1:66413196-66413218 GAGGAGGGCAGGCACTTCAAGGG + Intergenic
908671160 1:66549123-66549145 AAGGAAGGCAGGTAGCCAGAAGG - Intronic
911627336 1:100139540-100139562 GAGGATGGCAGGTACAGAGCAGG + Intronic
912505423 1:110152501-110152523 GAGGTGGGCAAGTCCTCTGAAGG + Intronic
912570658 1:110618727-110618749 GAGGAGTGGTGCTACTCAGAGGG - Intronic
912917124 1:113826433-113826455 GGGAAGGGAAGGGACTCAGAGGG + Intronic
913214993 1:116612821-116612843 GCTGAGGGCAGGTTCTCACATGG - Intronic
919795837 1:201320991-201321013 GTGGAGGGCAGATAAACAGAAGG + Intronic
919820568 1:201469325-201469347 GGGGAGGGCCGGGACTGAGAGGG + Intergenic
919847620 1:201651416-201651438 GAGGAGGGCAGGTGCAGGGAGGG + Intronic
919986881 1:202681668-202681690 GGGGACGGCAGGTCCTCAGATGG + Intronic
920030912 1:203036865-203036887 GTGGAGGGCAGGGTCCCAGAAGG - Intronic
920895284 1:210042133-210042155 CAGGAGGACAGGTCCCCAGATGG - Intronic
921293460 1:213680350-213680372 GAGCCGGGCTGGGACTCAGAAGG - Intergenic
922784899 1:228277957-228277979 GAGGACAGCAGGGACTCAGGAGG + Intronic
922918294 1:229277127-229277149 GAGGAAGGCAGTTACTTAGCAGG - Intronic
923410922 1:233708220-233708242 GAGGAGGGGCTGGACTCAGAGGG - Intergenic
924619521 1:245648715-245648737 CAGGAGGGCAGGTAGCCAGTTGG - Intronic
924627226 1:245705636-245705658 GAGGAGGACAGGTTCACACAAGG - Intronic
1063373504 10:5537521-5537543 GAGGAAGGCAGGAGGTCAGATGG - Intergenic
1063660032 10:8028977-8028999 GAGGCAGGCAGTTACTCAGGAGG - Intergenic
1064409550 10:15093148-15093170 GAGGAGGGGAGATTCTCAGTGGG + Intergenic
1065921275 10:30395080-30395102 GAGGAGGACAGCAACTGAGAAGG - Intergenic
1066295614 10:34051657-34051679 GAGGAGGACATCTTCTCAGATGG + Intergenic
1066506526 10:36050367-36050389 CAGGAGGTCAGGTTTTCAGAAGG + Intergenic
1067776750 10:49169937-49169959 GGGGAGGGCAGGGCCTCAGTGGG + Intronic
1068968031 10:62933379-62933401 GGGGTGGTCAGGTACTCACATGG - Intergenic
1069638203 10:69938266-69938288 GAGGTGGGGAGCTGCTCAGAAGG + Intronic
1070556133 10:77529210-77529232 GGGGAGGGCAGGAACACAGTGGG - Intronic
1070637825 10:78143306-78143328 GTGGAGAGCAGGGACTCAAAGGG + Intergenic
1070794604 10:79209450-79209472 AGGGAGGGCAGCTGCTCAGAAGG + Intronic
1071270655 10:84003911-84003933 GAGGAGGGAAGGTACTGGGGTGG - Intergenic
1072714698 10:97742979-97743001 GAGGAGGCCTGGAACACAGAAGG - Intronic
1073430714 10:103484978-103485000 GTGAAGGGCACATACTCAGAGGG + Intergenic
1074304362 10:112263032-112263054 GTGCAGGGTAGGTACTCAGATGG - Intergenic
1076040315 10:127241965-127241987 GAGGGTGCCAGGTACTCAGGAGG - Intronic
1076248210 10:128964131-128964153 GATGAGGGGTGGTGCTCAGAGGG - Intergenic
1076276671 10:129205278-129205300 GGGAAGGGCAGGCACTCAGAGGG - Intergenic
1076879910 10:133235250-133235272 GGGGAGGCCAGCTACTCAGGAGG - Intergenic
1077109927 11:857882-857904 GATGAGGGCAGGAGGTCAGAGGG - Intronic
1077352202 11:2098234-2098256 GGGGAGGGCAGGCGCCCAGAGGG - Intergenic
1078654237 11:13223274-13223296 CCCTAGGGCAGGTACTCAGAGGG - Intergenic
1080937203 11:36876632-36876654 GAAGAGGGAATGTACTCAGAGGG - Intergenic
1081686338 11:45045884-45045906 GAGGAGGGAAGTTATTCAGTGGG - Intergenic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1083804277 11:65064690-65064712 GAGGAGGGTAGAGTCTCAGAAGG + Intergenic
1085271795 11:75274055-75274077 TAGGAGGGCAGGTCCTCACAGGG + Exonic
1085414695 11:76312277-76312299 GAGGAAGGAAGGCAGTCAGAAGG + Intergenic
1087082356 11:94183833-94183855 AATGAAGGCAGGTACTCAAAAGG - Intergenic
1087222161 11:95558242-95558264 GAGGAGAACAGTTACTCAAATGG - Intergenic
1087457974 11:98411306-98411328 GAAGATGGCATGTATTCAGAAGG + Intergenic
1087661833 11:100997471-100997493 GGGGAGGGCAGCTTCTCATAGGG + Intergenic
1088240655 11:107770592-107770614 AAGGAAGGCTGGGACTCAGAAGG + Intergenic
1088933779 11:114378444-114378466 GAGGAGGGAAGGAAGGCAGAAGG + Intergenic
1089329432 11:117679375-117679397 CAGGAGGAGAGGCACTCAGAAGG + Intronic
1090024821 11:123158497-123158519 GAGGAGGGCAGGTCCACCCAGGG - Intronic
1090112667 11:123931596-123931618 GAGGAAGGCAGGAAGACAGAAGG - Intergenic
1091154048 11:133357276-133357298 GAGTTGGGCAGCTACTAAGAAGG - Intronic
1091549007 12:1523782-1523804 GAGGGCGGCAGGAACTCAGCAGG - Intergenic
1092136208 12:6149364-6149386 GAGAATGGCAGGAACCCAGAAGG - Intergenic
1094468397 12:30779124-30779146 GAGGAGGGCATACATTCAGATGG + Intergenic
1096910262 12:54976498-54976520 CAGGAGGGCAGGAATGCAGAAGG + Intronic
1100855053 12:98750778-98750800 GAGGAAGGCAGATGCTGAGAAGG + Intronic
1102010615 12:109616242-109616264 GAGGAGAGCAGGCACTCTGGGGG + Intergenic
1102302406 12:111780356-111780378 GAGGAGGGCGGGTCCCAAGACGG - Intronic
1103001030 12:117385394-117385416 GAGGAGAACAGGTATTCTGAAGG - Intronic
1103527598 12:121578614-121578636 GAGGAGGGCAGGCAGTAAGGGGG - Intronic
1103565878 12:121814969-121814991 GAGGGGGGCAGGTCCCCAGCCGG + Intronic
1104903737 12:132202790-132202812 AAGAAAGGCAGGTACTGAGACGG - Intronic
1105218725 13:18306298-18306320 GCTGAGGGCAGGTTCTCACATGG - Intergenic
1105426194 13:20297044-20297066 GAGGAGGACAGGGAGACAGAGGG - Intergenic
1105669704 13:22599235-22599257 TAGGATGTCAGGTACTCAGATGG + Intergenic
1109573808 13:64226977-64226999 GAGGATGGCATGAACCCAGAAGG + Intergenic
1109749923 13:66677106-66677128 TAGGATGACAGGTACTCTGATGG - Intronic
1113779304 13:112967020-112967042 GAAGAGGGCAGGTGCTCAGAGGG + Intronic
1114702423 14:24692753-24692775 GAGGTGGGCAGGAAGTCAAAGGG + Intergenic
1115554351 14:34532571-34532593 GAGGAGGGGAGGTATTGAGTTGG + Intronic
1115796537 14:36943594-36943616 CAGCAGGGCAGGGACTCAGAGGG - Intronic
1117943835 14:60997246-60997268 GAGGTGGGAAGCTACTCAGGAGG - Intronic
1118816273 14:69316506-69316528 CAGGAGGGCAGGGAATGAGAGGG + Intronic
1119137932 14:72237953-72237975 CAGGAAGCCAGGTACCCAGAGGG - Intronic
1121405051 14:93714649-93714671 GAGAAAGGCAGGTACACAGATGG + Intergenic
1121598511 14:95185125-95185147 GAAGAGGGCAGGTGCTCACGTGG + Exonic
1121788377 14:96680079-96680101 GCAGAGGGGAAGTACTCAGAGGG + Intergenic
1122409175 14:101517381-101517403 GAGGAAGGCACAAACTCAGAAGG + Intergenic
1123047421 14:105525922-105525944 AAGGAGGGCAGGCAGGCAGAAGG + Intergenic
1124796984 15:32791177-32791199 GTTTAGGGCAGGTTCTCAGAGGG + Intronic
1125501525 15:40242701-40242723 GTGGAGGGCACCTCCTCAGAAGG - Intronic
1126447763 15:48768150-48768172 GGGAAGGGCAGGGACTTAGAGGG + Intronic
1127537111 15:59900427-59900449 CAGAAGGGCAGGTATCCAGAGGG - Intergenic
1128227332 15:66011234-66011256 GAGGAGGGAGGGGACTGAGAAGG + Intronic
1129747793 15:78037174-78037196 GAGGAGGCCAGGGACTCCCAGGG - Intronic
1130053334 15:80502332-80502354 GAGGAGGACACGTCCTGAGAGGG + Intronic
1130474090 15:84248057-84248079 AGGGAGGGCAGGTAGCCAGATGG + Intergenic
1130481505 15:84362125-84362147 AGGGAGGGCAGGTAGCCAGATGG + Intergenic
1131165812 15:90141624-90141646 GAACAGGGCAGGTGCTCAGAGGG - Intergenic
1131397490 15:92098099-92098121 GAGCAAGGCAGGTCCACAGAGGG + Intronic
1132557178 16:577847-577869 CAGGAGGACAGGTCCCCAGAGGG - Intronic
1133110641 16:3546050-3546072 GTGGATGGCAGGGACACAGAGGG + Intronic
1134037118 16:11039700-11039722 GAGGAGGTCAGGTAGTCAGGAGG + Intronic
1136448681 16:30339894-30339916 GCGGAGGGCAGGCACTCACAGGG + Intergenic
1136710622 16:32234014-32234036 GAGGTGAGCAGGGACTCAGGGGG - Intergenic
1136872231 16:33817880-33817902 GAGGAGGGCAGATAATCTGCAGG - Intergenic
1137263780 16:46852245-46852267 GAAGAGGGCAGGAGCTCAGCAGG - Intergenic
1137265563 16:46866407-46866429 GAGGATGGCTGGAGCTCAGAAGG + Intergenic
1138486763 16:57350236-57350258 GGGTGGGGCAGGTGCTCAGAGGG - Intergenic
1138947752 16:61872743-61872765 GAGGAGGGCAGGTACTCAGATGG + Intronic
1139630973 16:68231729-68231751 AAGTAGGGCAGGGACACAGAGGG + Intronic
1139639835 16:68283304-68283326 GAGGATGGCAGGAAGACAGAAGG - Intronic
1139650757 16:68361092-68361114 GAGGAGGGCAGGGACAGGGAGGG - Exonic
1140450096 16:75063872-75063894 GAGGGGGGCAGATACACACAGGG - Intronic
1140470526 16:75211698-75211720 CAGAAGGGCAGATGCTCAGAGGG - Intergenic
1141163997 16:81648060-81648082 GTGGAGGCCAGGTAACCAGAAGG - Intronic
1141537471 16:84692446-84692468 GAGGAGAGCAGGAAGGCAGAGGG - Intergenic
1142047181 16:87932969-87932991 GCGGAGGGCAGGCACTCACAGGG - Intronic
1142280918 16:89147160-89147182 GAGGAGGGAGGGTCCACAGAGGG + Intronic
1203059439 16_KI270728v1_random:955748-955770 GAGGTGAGCAGGGACTCAGGGGG + Intergenic
1203099941 16_KI270728v1_random:1298188-1298210 GAGGAGGGCAGATAATCTGCAGG + Intergenic
1142997342 17:3768735-3768757 GATGATGGCAGGTTCTGAGAAGG - Intronic
1143036601 17:4003232-4003254 GAGCAGCCCAGGCACTCAGACGG - Intergenic
1143157572 17:4848061-4848083 GAGGACGGGAGGGACTCTGAAGG + Intronic
1144018809 17:11222044-11222066 GAGAAGGTCATGTACACAGAAGG + Intergenic
1144631232 17:16873500-16873522 CAGGAGGGCTGTTACTCAGAAGG + Intergenic
1145939803 17:28737454-28737476 GAGGAGGGCACGGATGCAGAGGG - Exonic
1146545945 17:33738589-33738611 GAGGAGGGAAGGCAGTAAGAAGG - Intronic
1148123066 17:45223526-45223548 GAGGAGGGCAGGGACACTGAGGG + Intronic
1148691419 17:49529074-49529096 GAGGAGGGTAAGGAATCAGAGGG - Intergenic
1151954286 17:77372996-77373018 GAGGAGGGCGGGCGCCCAGAGGG - Intronic
1152188086 17:78871020-78871042 GAGGAGGACATGTAAGCAGAGGG + Intronic
1152586106 17:81190193-81190215 GGGGAGGCCTGGTACCCAGATGG + Intronic
1152878253 17:82800634-82800656 CAGGAGAGCAAGTACTCAGAGGG - Intronic
1153952334 18:10067877-10067899 GAAGAGGGCCGGTGCTCAGGAGG - Intergenic
1154350413 18:13578466-13578488 GAGGAGGACAGTTACAAAGAAGG - Intronic
1155300263 18:24422675-24422697 GAGTATGGCAGTTACTCAGGTGG - Intergenic
1155893954 18:31300299-31300321 GAGGAGTGAAGATACTCATAAGG - Intergenic
1156388033 18:36624535-36624557 GTGGAGGAGAGTTACTCAGAAGG + Intronic
1156461705 18:37325034-37325056 GAGGAGAGCAGGGAGCCAGATGG + Intronic
1158817658 18:61122189-61122211 GAGGAAGGCAGATTGTCAGAAGG - Intergenic
1159202607 18:65206697-65206719 AAGGAATGCAGGTACACAGAAGG + Intergenic
1159603978 18:70455912-70455934 GAGTAGGGCAGTGACTCACAAGG + Intergenic
1159954848 18:74512000-74512022 GAGGAGGCCGGGCACTCAGCAGG + Intronic
1160135077 18:76264781-76264803 CAGGAGGGCAGGAGATCAGATGG + Intergenic
1160150331 18:76392928-76392950 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150359 18:76392997-76393019 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150396 18:76393089-76393111 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150406 18:76393112-76393134 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150452 18:76393227-76393249 GGGGAGGGCAGGTAGTCAGGTGG + Intronic
1160150489 18:76393324-76393346 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150508 18:76393370-76393392 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150555 18:76393490-76393512 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150603 18:76393605-76393627 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150705 18:76393858-76393880 GGGGAGGGCAGGTAGTCAGGTGG + Intronic
1160150742 18:76393955-76393977 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150768 18:76394016-76394038 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150815 18:76394136-76394158 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150843 18:76394205-76394227 GGGGAGGGCAGGTAGTCAGGTGG + Intronic
1160150880 18:76394302-76394324 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150899 18:76394348-76394370 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150918 18:76394394-76394416 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150965 18:76394514-76394536 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160151059 18:76394744-76394766 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160210405 18:76873782-76873804 GAGGAGGGCAGGCAGGCAGGAGG - Intronic
1160500248 18:79398088-79398110 GAGGCGCCCAGGTCCTCAGATGG - Intronic
1160710747 19:549925-549947 GAGGTGGGCTGGGACTCAGGCGG - Intergenic
1160770480 19:828699-828721 GAGAAGGGAAGGGGCTCAGATGG + Intronic
1160770513 19:828801-828823 GAGAAGGGAAGGGGCTCAGATGG + Intronic
1160770521 19:828834-828856 GAGAAGGGAAGGGGCTCAGATGG + Intronic
1160770534 19:828900-828922 GAGAAGGGAAGGGCCTCAGATGG + Intronic
1160770665 19:829296-829318 GAGAAGGGAAGGGACTCAGATGG + Intronic
1161767214 19:6214385-6214407 GAAGAGGGCAGGTTTTCAGCAGG - Intronic
1161816079 19:6501088-6501110 GAGGAGGGCGGATACAGAGAAGG - Intronic
1162220809 19:9174623-9174645 GAGAAGGGCATGAACCCAGAAGG - Intergenic
1162593504 19:11608959-11608981 GAGGATGGCTTGAACTCAGAAGG - Intronic
1162621467 19:11847678-11847700 GAGGAGAGCAGGGACTCTGCTGG + Intergenic
1162625250 19:11879948-11879970 GAGGAGAGCAGGGACTCTGCTGG + Intronic
1162630488 19:11923714-11923736 GAGGAGAGCAGGGACTCTGCTGG + Intergenic
1162780064 19:13002293-13002315 GAGGAGGAGAGATATTCAGACGG - Intronic
1163387415 19:17008351-17008373 GCGGAGGGCAGGTACCCACCTGG - Intronic
1163799198 19:19354796-19354818 GAGCAGGGCGGGCACTCAGCGGG + Intronic
1164231403 19:23291130-23291152 TATGAGGGCAGGGACTCAGTCGG - Intergenic
1164726552 19:30469320-30469342 GAGGATGGCATGAACCCAGAAGG + Intronic
1166976312 19:46607128-46607150 GGGGAGGGCAGGTAGTGAGTGGG - Intronic
1167077865 19:47260111-47260133 GGGGAAGGCTGTTACTCAGAGGG + Intronic
1167348963 19:48963256-48963278 GAGGAGGGCAGAGACCCAGAGGG - Intergenic
1167716424 19:51145109-51145131 GAAGAGGACAGGTGCTCAGGTGG - Intronic
1167971779 19:53192413-53192435 GAGAGGGGCAGCTCCTCAGACGG - Intronic
925275474 2:2645181-2645203 GAGGAGGCCAGGTTTTCTGAAGG - Intergenic
926002582 2:9345751-9345773 GAGCTGGGCAGGAGCTCAGAGGG + Intronic
927507030 2:23621370-23621392 CAGGAGGGCAGGGACTCAGGAGG - Intronic
928419032 2:31123090-31123112 GAGGACGGCATGAACTCAGGAGG + Intronic
928813948 2:35266333-35266355 TAACAGGGCAGGTACTCAGGGGG - Intergenic
929444464 2:41991860-41991882 GAGGAGGGCAGATAAGCAGAGGG + Intergenic
933617580 2:84498683-84498705 TAGCAGGGCAGGTGCTGAGATGG - Intergenic
934295590 2:91740332-91740354 GCTGAGGGCAGGTTCTCACATGG + Intergenic
934748402 2:96775233-96775255 GAGCAGGGCAGGGACTGGGAGGG - Intronic
935117288 2:100147331-100147353 GAGGATGGCAAGGACACAGAGGG + Intergenic
935205777 2:100895592-100895614 GAGGAGGGCTGGAACTCCTAAGG - Intronic
935512628 2:103994911-103994933 GAGGAGGGGAGCATCTCAGATGG - Intergenic
936455872 2:112673899-112673921 GAGGAGGGCAGGCAGGCAGCTGG + Intergenic
936473152 2:112816486-112816508 CAGGAGGCCTGGTATTCAGAGGG + Intergenic
936875445 2:117184005-117184027 GAGGAAGGGGTGTACTCAGAAGG - Intergenic
937017528 2:118619380-118619402 GAGGAAGGCAGGCACCCAGGAGG - Intergenic
937146496 2:119649855-119649877 CAGGAGGCCAGGTCCTCAGATGG - Intronic
937253873 2:120541207-120541229 GAGGTGGGAAGGTCCCCAGACGG - Intergenic
937299423 2:120830152-120830174 TGGGATGGCAGGTACTCAGACGG - Intronic
945561850 2:211349254-211349276 GGGGATGGCAGGAAGTCAGAGGG + Intergenic
946179863 2:217942770-217942792 GAGGAGGGCAGGCAGGCAGGCGG - Intronic
948265495 2:236632729-236632751 GAGCAGGGCAGGAGTTCAGAGGG + Intergenic
949027652 2:241773974-241773996 GTTGTGGGCAGGTCCTCAGACGG + Intergenic
1169336689 20:4762648-4762670 CAGGAGGGCAGGTACGCAAGAGG + Intergenic
1172106724 20:32521611-32521633 GAGGAGGACAGGGATGCAGAGGG + Intronic
1172145147 20:32752352-32752374 GCGGAGGGAAGGTAAGCAGATGG + Intergenic
1172799627 20:37566802-37566824 GGGGAGGGCTGGGACTCTGAGGG + Intergenic
1173404783 20:42755066-42755088 GAGGAGACCAGGTAATGAGAAGG + Intronic
1174386099 20:50189462-50189484 GAGGCGGGCAAGTGGTCAGAAGG + Intergenic
1175261288 20:57675663-57675685 GAGGAGGGAAGGAGCTCAGATGG + Intronic
1175282645 20:57814377-57814399 GAGGAGGGCATGTGCTGAGGAGG - Intergenic
1175813233 20:61870028-61870050 GATCAGGGCAGGCACTCAAAGGG + Intronic
1175944757 20:62553523-62553545 GAGGAGTCCAGGTTCCCAGAGGG - Exonic
1178016491 21:28352152-28352174 TAGGTGAGCATGTACTCAGATGG - Intergenic
1178064128 21:28885185-28885207 GAGGAGGGGAGGGGCTCTGACGG - Intronic
1178379568 21:32096573-32096595 GAGGAGGGCAGGTGCAAAGGAGG - Intergenic
1178411313 21:32365895-32365917 GGGGAGGACAGGTATTCAGAAGG - Intronic
1179076119 21:38123478-38123500 GAGGAGGGCAGGGAGTCTGAAGG - Intronic
1180244074 21:46534666-46534688 CAGGCGTGCGGGTACTCAGAAGG + Exonic
1180743019 22:18066887-18066909 GTGGAGACCAGGTTCTCAGATGG + Intergenic
1181326220 22:22049143-22049165 CAGGAGGGCAGGAACTGGGAGGG - Intergenic
1182283818 22:29232484-29232506 GAGCAGGGCTGGCACACAGAAGG - Intronic
1182353160 22:29710224-29710246 GAGCAGGGCAGGTGAGCAGATGG + Intergenic
1182835081 22:33335330-33335352 AAGGAGGGCAGATGCTGAGAAGG + Intronic
1183265791 22:36824279-36824301 GAAGGAGGCATGTACTCAGAAGG + Intergenic
1184444311 22:44538562-44538584 CAGGAGGGTAGGGACTCAGGTGG - Intergenic
1184776691 22:46626958-46626980 GACGAGGACAGGTACTCACAGGG - Exonic
1184777008 22:46628291-46628313 GACAAGGACAGGTACTCACAGGG - Intronic
1185070391 22:48652776-48652798 GAGGCAGGCAGGTACCCAGCTGG - Intronic
1185290146 22:50020356-50020378 GAGGAGTGCACGTCATCAGATGG - Intronic
1185290159 22:50020501-50020523 GAGGAGTGCATGTTGTCAGATGG - Intronic
1185290165 22:50020564-50020586 GAGGAGTGCACGTTGTCAGATGG - Intronic
1185290173 22:50020627-50020649 GAGGAGTGCACGTTGTCAGATGG - Intronic
1185290175 22:50020649-50020671 GAGGAGTGCATGTTGTCAGATGG - Intronic
1185290177 22:50020671-50020693 GAGGAGTGCACGTTGTCAGATGG - Intronic
1185290187 22:50020791-50020813 GAGGAGTGCATGTTGTCAGATGG - Intronic
1185290244 22:50021373-50021395 GAGGAGTGCACGTCATCAGATGG - Intronic
1185290256 22:50021496-50021518 GAGGAGTGCACGTCATCAGATGG - Intronic
1185290266 22:50021597-50021619 GAGGAGTGCACGTCGTCAGATGG - Intronic
1185290272 22:50021660-50021682 GAGGAGTGCACGTCGTCAGATGG - Intronic
1185290284 22:50021780-50021802 GAGGAGTGCACGTCGTCAGATGG - Intronic
1185290288 22:50021821-50021843 GAGGAGTGCACGTCGTCAGATGG - Intronic
1185290302 22:50021963-50021985 GAGGAGTGCACGTCGTCAGATGG - Intronic
1185290311 22:50022067-50022089 GAGGAGTGCATGTCGTCAGATGG - Intronic
1185290319 22:50022149-50022171 GAGGAGTGCACGTCATCAGATGG - Intronic
1185290363 22:50022624-50022646 GAGGAGTGCACGTCGTCAGATGG - Intronic
1185400643 22:50613785-50613807 CAGGAGAGCAAGTCCTCAGAAGG - Intronic
949495010 3:4622967-4622989 GAGGAGGGCATGGACACAGTGGG + Intronic
949549881 3:5104102-5104124 GAGGAGGGGAGGAAGTCAGGGGG - Intergenic
950427392 3:12931801-12931823 GGGGAGGCCAGGTCCACAGAAGG + Intronic
951693131 3:25417966-25417988 GAGGAGGACAGCAACCCAGAGGG - Intronic
953062033 3:39435276-39435298 GAGGAGGGTGACTACTCAGAGGG + Intergenic
953836790 3:46353159-46353181 GAGGATGGCTTGAACTCAGAAGG + Intergenic
954258364 3:49421725-49421747 GGGGAGGTCAGGAAATCAGAAGG - Intronic
954284239 3:49607410-49607432 GAGAAGGGCAAGTGCTCTGAGGG - Intronic
955079377 3:55644045-55644067 GAGGAGGGCAGGGTGTGAGAGGG + Intronic
955470549 3:59282137-59282159 GAGGAGAGCAGGTGGTCAGAGGG + Intergenic
955492752 3:59499489-59499511 GAGGAGGGCAGGCAGGGAGAGGG + Intergenic
956179664 3:66505284-66505306 GAGGAGGGCAGATCCTGTGAAGG - Intergenic
961431641 3:126888152-126888174 GAGGAGGGAAGGCACACACAAGG + Intronic
961974666 3:131010586-131010608 AAGGGGGACAGGTACTCACATGG + Intronic
962404392 3:135087984-135088006 CAGGCAGGCAGGAACTCAGAGGG + Intronic
963204018 3:142614391-142614413 GAGGATGGCAGGGAATCACAAGG + Intronic
963744219 3:149109731-149109753 GAGGAGTGCAGGTGCACAGCAGG + Intergenic
965914455 3:173826282-173826304 GAGGAGGTCAGGTATTGAGATGG - Intronic
966571551 3:181449573-181449595 GAGAATGGCATGAACTCAGAAGG + Intergenic
968852532 4:3093285-3093307 GAGCAGGTAGGGTACTCAGAAGG + Intronic
969057289 4:4409849-4409871 GAGCAGGGCAGGTAGGCAGGGGG + Intronic
969060654 4:4431718-4431740 GAGGAGGGAGGGTGCACAGAAGG - Intronic
975245026 4:72110437-72110459 GAAGTGGGCAAGTACACAGAAGG - Intronic
976578228 4:86701624-86701646 AAGGAGGCAAGATACTCAGATGG + Exonic
977918512 4:102619439-102619461 GAGGGAGGCAGGTGTTCAGATGG - Intergenic
980953473 4:139404952-139404974 ACTGAGGGCAGGTACTGAGAAGG - Intronic
981087936 4:140702856-140702878 GAGCAGGGCTTGGACTCAGAAGG + Intronic
981872095 4:149498552-149498574 GAGCAGGGCAGGAACTAAGAGGG + Intergenic
983043796 4:162960769-162960791 AAGGAAGCCAGGGACTCAGATGG - Intergenic
983843116 4:172481871-172481893 GAGGAGTGCAGGTACTGTGTTGG - Intronic
984734908 4:183099540-183099562 GAGGAGGCCAGGGACTACGACGG + Exonic
988049428 5:26006856-26006878 GCGGAGGACAGGAACTCGGAAGG - Intergenic
988314975 5:29613441-29613463 GAGAATGGCATGAACTCAGAAGG + Intergenic
988906765 5:35798454-35798476 GAGGAGGGCAGGGAGTTAGCTGG - Intronic
990646631 5:57852594-57852616 GAAGAAGGCAGGTAAACAGAAGG - Intergenic
991660387 5:68945280-68945302 ATGGAGGCCGGGTACTCAGAAGG - Intergenic
995536202 5:113138803-113138825 GAGAATGGCAGGTACTTATAAGG - Intronic
997010766 5:129874860-129874882 CAGGAGGGCAGGTCCCCAAAGGG + Intergenic
999198473 5:149799327-149799349 GAGGAGAGCAGAGAATCAGAGGG - Intronic
999272152 5:150302827-150302849 GAGGTGGGCAGGACCCCAGAGGG + Exonic
999318831 5:150601032-150601054 GAGGAGGGCAGGGTGTCAGGGGG - Intergenic
999357625 5:150951471-150951493 GAAGAAGGCTCGTACTCAGAGGG + Intergenic
999457866 5:151732867-151732889 CAGGAGGGCAGGGAAGCAGAGGG + Intergenic
1001083455 5:168683744-168683766 GAGGAAGGCAGGCCCGCAGAGGG - Intronic
1001565247 5:172695856-172695878 GGGGAGGGCAGGTCCTCTGCTGG - Intergenic
1003614300 6:7641431-7641453 CAGGAGGACAGGTGCCCAGATGG - Intergenic
1004780457 6:18902830-18902852 GATGAAGGGAGGTACTCAGTAGG + Intergenic
1005580932 6:27233911-27233933 GAGTAGGCCAGGGATTCAGATGG - Intergenic
1006019512 6:31109785-31109807 GACCAGGGCAGGCACTCAGCAGG - Intergenic
1006607183 6:35266466-35266488 AAGGAGGGCAGGTTGTTAGAAGG + Intronic
1009564004 6:65287079-65287101 AAGTAGGGCAGGTATACAGAGGG + Intronic
1013555647 6:111254523-111254545 GAGGAGGCCACTTACTCAAAGGG - Intergenic
1015062106 6:128978609-128978631 GAGAAGGGCAGGTACTGACCGGG - Intronic
1017449263 6:154538818-154538840 TAGGAGGGCAGGAGCTGAGATGG + Intergenic
1017598595 6:156057549-156057571 GAGGAGAGAAATTACTCAGAAGG - Intergenic
1018172235 6:161152273-161152295 GGGCAGGGCAGGCACACAGAGGG + Intronic
1018197647 6:161368902-161368924 GAGAAGGGCAGGAACTCCAAGGG - Intronic
1019159990 6:170063247-170063269 GAGGATGGGAGGAACTAAGAGGG - Intergenic
1019444995 7:1066593-1066615 TAGGAGGGCAGGTAGGTAGAGGG - Intronic
1019484750 7:1284407-1284429 GAGCAGGGCAGGGGCTCAGGAGG - Intergenic
1019489766 7:1306837-1306859 GAGGAGGGCATTTACTCAGGTGG + Intergenic
1019585960 7:1803676-1803698 GAGGAGGGCAGGTTGTCTGTGGG + Intergenic
1020212357 7:6166298-6166320 GAGGAGGGCAGGTACAGATGGGG - Intronic
1020391725 7:7665687-7665709 GGGGAGGGGAGGAACACAGAGGG - Intronic
1021131321 7:16916102-16916124 TAGGAGGGCAGGTCCTCAAGTGG - Intergenic
1021586535 7:22214741-22214763 AAAGAGGGCATGCACTCAGAGGG - Intronic
1022218270 7:28286776-28286798 GAGGAGGGCTGGAACCCAGGAGG + Intergenic
1023247318 7:38219022-38219044 TAGGAAGGCAGGTACTCACAAGG + Intronic
1024570352 7:50718031-50718053 GAGGAGGCCAGGGACTCAGTCGG + Intronic
1024992695 7:55248667-55248689 CAGCAGGGCAGGTTCTCAGCTGG + Intronic
1029234094 7:99098790-99098812 GAGGAGGGAAGATGATCAGAGGG - Intronic
1031415920 7:121496607-121496629 GTGGAAGGCAGGCTCTCAGATGG + Intergenic
1032511805 7:132478744-132478766 GATGAGGGCAGGTCGTCAGGTGG + Intronic
1033441898 7:141387708-141387730 GAGGTGGGCAGGTGGGCAGAGGG - Intronic
1034064640 7:148124497-148124519 CAGTAGGGCAGGTGCTCAGGAGG - Intronic
1034226835 7:149490943-149490965 GAGGATGACAAGCACTCAGAGGG + Intronic
1034241978 7:149617701-149617723 GAGGATGACAAGCACTCAGAGGG + Intergenic
1034423728 7:151002141-151002163 GAGGAGGGCAGGGCCTCCGGGGG + Intronic
1035160242 7:156944735-156944757 GAGCAGGGAAGGGACCCAGAAGG - Intergenic
1035345477 7:158194426-158194448 GAGGGCGGCAGGTTCACAGAGGG - Intronic
1035472117 7:159117106-159117128 GAGGAGACCAGGTTCACAGAGGG + Intronic
1037285663 8:17296251-17296273 GTGGAGGGCAGGTATTCACGTGG + Exonic
1038338423 8:26663647-26663669 GAGGAGGACAGATGCCCAGAGGG - Intergenic
1039523104 8:38189077-38189099 GTGGCGGGCAGCTACTCAGGAGG - Intronic
1040285934 8:46100425-46100447 GAAGGGCGCAGGGACTCAGAGGG - Intergenic
1040303548 8:46200486-46200508 GAGGATCGCAGTTACTCAGGGGG + Intergenic
1040305399 8:46209290-46209312 GTGGGCGGCAGGGACTCAGAGGG + Intergenic
1040318347 8:46276651-46276673 TGGGAGAGCAGGAACTCAGAAGG - Intergenic
1040324698 8:46335778-46335800 GCGGGTGGCAGGGACTCAGATGG + Intergenic
1040331922 8:46390032-46390054 GAGGGCTGCAGGGACTCAGAGGG + Intergenic
1040334272 8:46408158-46408180 GAGGGTGGCAGGGACTCAGGGGG + Intergenic
1040337051 8:46421328-46421350 GAGGGCTGCAGGGACTCAGAGGG + Intergenic
1040392182 8:46959667-46959689 GAGGAGGGAAGGGAGGCAGAAGG + Intergenic
1041463159 8:58133518-58133540 GAGGAAGGATGGGACTCAGAGGG + Intronic
1043557930 8:81455223-81455245 GAGCAGGGCTGGTAGTTAGATGG + Intergenic
1044891822 8:96844277-96844299 GAGGTGGGGAGGAACACAGAGGG - Intronic
1044926663 8:97214938-97214960 GAGGAAGGTAGGCACTCAGAAGG - Intergenic
1046098480 8:109587650-109587672 GAGGAAGGTAGGTAATCACAAGG + Intronic
1047124826 8:121948455-121948477 GAGGAGTGCAGGCACACAGGAGG + Intergenic
1048390114 8:133954954-133954976 GAGGAAGGCAGGAAGACAGATGG - Intergenic
1048672224 8:136735832-136735854 GAGGCTGTCAGGAACTCAGATGG + Intergenic
1049329699 8:142043637-142043659 CAGGAGGGCAGGATCTGAGAGGG + Intergenic
1052280336 9:26725784-26725806 AAGGAGGGCTATTACTCAGATGG - Intergenic
1053471464 9:38348556-38348578 GGGGAGGGCAGGTGCTGGGATGG + Intergenic
1055297777 9:74852012-74852034 GAGGGGGGTAGCTACTCAGGAGG + Intronic
1056815288 9:89796679-89796701 GAGGAGGCCAAGTGCTCACAGGG + Intergenic
1057954044 9:99393211-99393233 AAGGAGAGGAGATACTCAGAAGG + Intergenic
1060257905 9:122048598-122048620 GAGGTGGGCAGGTTGGCAGAGGG - Intronic
1060668482 9:125447825-125447847 GAGGAGGGCAGGGAGTCAGCTGG + Intronic
1060757138 9:126222459-126222481 GAGGAGGGAAGGAAGACAGAAGG + Intergenic
1061832279 9:133303737-133303759 GAGGAGGGCAGGTATGCAGGTGG + Intergenic
1061840859 9:133357847-133357869 AAGGCGGGCATGCACTCAGATGG - Intronic
1061866075 9:133492418-133492440 GAGGCGGGCAGGGACTCGGGGGG - Intergenic
1062031733 9:134364959-134364981 TAAGAGGGCAGGTAAGCAGAAGG - Intronic
1062136644 9:134932320-134932342 GAGGAGTTAAGGTCCTCAGATGG - Intergenic
1062345813 9:136114657-136114679 CAGGCGGCCAGGTGCTCAGAGGG + Exonic
1185635814 X:1550903-1550925 GAGAATGGCAGGAACCCAGAAGG + Intergenic
1187103850 X:16220799-16220821 GAGGAGGGGAGGTAATAGGAGGG + Intergenic
1187282009 X:17864535-17864557 GAGGAGGGAAGGAAGCCAGAGGG + Intergenic
1187403329 X:18981891-18981913 GATGAGGGCATGGACTCAGAAGG + Intronic
1187518358 X:19991807-19991829 GAGGATGGCAGTAAATCAGATGG - Intergenic
1187925344 X:24244624-24244646 GAGGATGGCTGGAACTCAGGGGG + Intergenic
1188009009 X:25038626-25038648 CAGGATGGCTGGTGCTCAGAAGG + Intergenic
1188105234 X:26141116-26141138 GCAGAGGCCAGGCACTCAGATGG + Intergenic
1190221380 X:48514422-48514444 GAGGAGGGCGGGTGCTCCCAGGG + Intronic
1190292355 X:49001315-49001337 GGGGAGGGGAGGAACTCTGAGGG - Intronic
1190595939 X:52052748-52052770 GAGGAGGGCAGAAACGCAGACGG - Exonic
1190612885 X:52201325-52201347 GAGGAGGGCAGAAACGCAGACGG + Exonic
1192172898 X:68867813-68867835 GAGGAGGGGAGTTTTTCAGATGG - Intergenic
1192263852 X:69525184-69525206 GAGGAGGGCAGGAACTCCACTGG + Intronic
1195108487 X:101623180-101623202 GTGGGGAGCTGGTACTCAGACGG - Exonic
1196442367 X:115728474-115728496 GACTAGGGCAGGTGCTCGGACGG - Intergenic
1196443190 X:115732430-115732452 GACTAGGGCAGGTGCTCGGACGG + Intergenic
1196444325 X:115737499-115737521 GACTAGGGCAGGTGCTCGGACGG - Intergenic
1196445511 X:115844345-115844367 GACTAGGGCAGGTGCTCGGACGG + Intergenic
1196446182 X:115847326-115847348 GACTAGGGCAGGTGCTCGGACGG + Intergenic
1196446853 X:115850307-115850329 GACTAGGGCAGGTGCTCGGACGG + Intergenic
1196447521 X:115853290-115853312 GACTAGGGCAGGTGCTCGGACGG + Intergenic
1196448192 X:115856269-115856291 GACTAGGGCAGGTGCTCGGACGG + Intergenic
1196448861 X:115859260-115859282 GACTAGGGCAGGTGCTCGGACGG + Intergenic
1196449532 X:115862251-115862273 GACTAGGGCAGGTGCTCGGACGG + Intergenic
1196450201 X:115865234-115865256 GACTAGGGCAGGTGCTCGGACGG + Intergenic
1196450871 X:115868219-115868241 GACTAGGGCAGGTGCTCGGACGG + Intergenic
1196451542 X:115871198-115871220 GACTAGGGCAGGTGCTCGGACGG + Intergenic
1196452213 X:115874185-115874207 GACTAGGGCAGGTGCTCGGACGG + Intergenic
1196452883 X:115877154-115877176 GACTAGGGCAGGTGCTCGGACGG + Intergenic
1196453553 X:115880147-115880169 GACTAGGGCAGGTGCTCGGACGG + Intergenic
1196454222 X:115883156-115883178 GACTAGGGCAGGTGCTCGGACGG + Intergenic
1196608278 X:117680988-117681010 GAGGATGGAAGGTAGACAGAGGG + Intergenic
1196652641 X:118183963-118183985 GAGGAGGGAATGTACTCTGAGGG + Intergenic
1198230314 X:134682874-134682896 GAGGATGTCAGCTAATCAGATGG + Intronic
1198456359 X:136821630-136821652 GAGGGGGGCAGATCCTGAGATGG - Intergenic
1200072937 X:153537934-153537956 GAGAAGGGCAGGTGCACAGGTGG + Intronic
1200848174 Y:7853231-7853253 GAGGATGGCATGAACCCAGAAGG + Intergenic
1201146175 Y:11066729-11066751 GAGGAAGGGAGGCACTGAGAGGG + Intergenic
1202376829 Y:24245995-24246017 ATGGAGGGCAGGTAGCCAGATGG - Intergenic
1202493951 Y:25424126-25424148 ATGGAGGGCAGGTAGCCAGATGG + Intergenic